Gene Page: BTN2A1
Summary ?
GeneID | 11120 |
Symbol | BTN2A1 |
Synonyms | BK14H9.1|BT2.1|BTF1|BTN2.1|DJ3E1.1 |
Description | butyrophilin subfamily 2 member A1 |
Reference | MIM:613590|HGNC:HGNC:1136|Ensembl:ENSG00000112763|HPRD:12544|Vega:OTTHUMG00000014457 |
Gene type | protein-coding |
Map location | 6p22.1 |
Pascal p-value | 5.137E-12 |
Sherlock p-value | 0.805 |
Fetal beta | 0.325 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Support | Ascano FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
GSMA_I | Genome scan meta-analysis | Psr: 0.033 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg07722505 | 6 | 26458093 | BTN2A1 | 2.37E-8 | -0.01 | 7.8E-6 | DMG:Jaffe_2016 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs12120957 | chr1 | 197953741 | BTN2A1 | 11120 | 0.05 | trans | ||
rs16829545 | chr2 | 151977407 | BTN2A1 | 11120 | 0 | trans | ||
rs7584986 | chr2 | 184111432 | BTN2A1 | 11120 | 0.02 | trans | ||
rs16955618 | chr15 | 29937543 | BTN2A1 | 11120 | 9.702E-4 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
DOCK3 | 0.75 | 0.81 |
KCNQ5 | 0.74 | 0.76 |
AP000751.3 | 0.73 | 0.79 |
ATP2B2 | 0.73 | 0.76 |
SPRED2 | 0.73 | 0.79 |
DLGAP1 | 0.73 | 0.77 |
FRMPD4 | 0.73 | 0.76 |
STXBP5 | 0.73 | 0.76 |
STXBP1 | 0.72 | 0.76 |
CAMTA1 | 0.71 | 0.71 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
DBI | -0.48 | -0.60 |
RAB34 | -0.46 | -0.54 |
MYL12A | -0.46 | -0.57 |
RAB13 | -0.45 | -0.56 |
ACAA2 | -0.45 | -0.52 |
GNG11 | -0.45 | -0.58 |
PHYHD1 | -0.44 | -0.53 |
ACSF2 | -0.44 | -0.53 |
C1orf61 | -0.44 | -0.62 |
C1orf54 | -0.44 | -0.61 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003674 | molecular_function | ND | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006629 | lipid metabolic process | TAS | 9382921 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0016020 | membrane | IEA | - | |
GO:0005887 | integral to plasma membrane | TAS | 9382921 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
LIU PROSTATE CANCER DN | 481 | 290 | All SZGR 2.0 genes in this pathway |
PRAMOONJAGO SOX4 TARGETS UP | 52 | 38 | All SZGR 2.0 genes in this pathway |
GINESTIER BREAST CANCER 20Q13 AMPLIFICATION DN | 180 | 101 | All SZGR 2.0 genes in this pathway |
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS MAGENTA UP | 28 | 18 | All SZGR 2.0 genes in this pathway |
PATIL LIVER CANCER | 747 | 453 | All SZGR 2.0 genes in this pathway |
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN | 584 | 395 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
BENPORATH MYC MAX TARGETS | 775 | 494 | All SZGR 2.0 genes in this pathway |
ZHANG RESPONSE TO IKK INHIBITOR AND TNF UP | 223 | 140 | All SZGR 2.0 genes in this pathway |
HADDAD B LYMPHOCYTE PROGENITOR | 293 | 193 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
KAYO AGING MUSCLE UP | 244 | 165 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 12HR UP | 111 | 68 | All SZGR 2.0 genes in this pathway |
BONOME OVARIAN CANCER SURVIVAL OPTIMAL DEBULKING | 246 | 152 | All SZGR 2.0 genes in this pathway |
WEST ADRENOCORTICAL CARCINOMA VS ADENOMA DN | 24 | 18 | All SZGR 2.0 genes in this pathway |
CHEN HOXA5 TARGETS 9HR UP | 223 | 132 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH T 8 21 TRANSLOCATION | 368 | 247 | All SZGR 2.0 genes in this pathway |
DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-342 | 272 | 279 | 1A,m8 | hsa-miR-342brain | UCUCACACAGAAAUCGCACCCGUC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.