Gene Page: GABARAP
Summary ?
| GeneID | 11337 |
| Symbol | GABARAP |
| Synonyms | ATG8A|GABARAP-a|MM46 |
| Description | GABA(A) receptor-associated protein |
| Reference | MIM:605125|HGNC:HGNC:4067|HPRD:05496| |
| Gene type | protein-coding |
| Map location | 17p13.1 |
| Pascal p-value | 2.022E-4 |
| Sherlock p-value | 0.987 |
| Fetal beta | 0.45 |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs6516671 | chr21 | 26806125 | GABARAP | 11337 | 0.07 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0050811 | GABA receptor binding | IPI | GABA (GO term level: 5) | 9892355 |
| GO:0005515 | protein binding | IPI | 11096062 |11146101 | |
| GO:0008017 | microtubule binding | IEA | - | |
| GO:0048487 | beta-tubulin binding | IDA | 9892355 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007268 | synaptic transmission | TAS | neuron, Synap, Neurotransmitter (GO term level: 6) | 9892355 |
| GO:0000226 | microtubule cytoskeleton organization | IEA | - | |
| GO:0006605 | protein targeting | TAS | 9892355 | |
| GO:0015031 | protein transport | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0000139 | Golgi membrane | IEA | - | |
| GO:0000421 | autophagic vacuole membrane | IDA | 15169837 | |
| GO:0005794 | Golgi apparatus | IEA | - | |
| GO:0005874 | microtubule | IEA | - | |
| GO:0005875 | microtubule associated complex | IEA | - | |
| GO:0005790 | smooth endoplasmic reticulum | IEA | - | |
| GO:0005737 | cytoplasm | IEA | - | |
| GO:0005764 | lysosome | IEA | - | |
| GO:0005886 | plasma membrane | TAS | 9892355 | |
| GO:0015629 | actin cytoskeleton | IEA | - |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| ATG3 | APG3 | APG3-LIKE | APG3L | DKFZp564M1178 | FLJ22125 | MGC15201 | PC3-96 | ATG3 autophagy related 3 homolog (S. cerevisiae) | - | HPRD | 11825910 |
| ATG4B | APG4B | AUTL1 | MGC1353 | ATG4 autophagy related 4 homolog B (S. cerevisiae) | Two-hybrid | BioGRID | 16169070 |
| ATG7 | APG7-LIKE | APG7L | DKFZp434N0735 | GSA7 | ATG7 autophagy related 7 homolog (S. cerevisiae) | - | HPRD | 11890701 |
| GABARAP | FLJ25768 | MGC120154 | MGC120155 | MM46 | GABA(A) receptor-associated protein | - | HPRD,BioGRID | 11779480 |12367594 |
| GABRG2 | CAE2 | ECA2 | GEFSP3 | gamma-aminobutyric acid (GABA) A receptor, gamma 2 | - | HPRD,BioGRID | 9892355 |
| GPHN | GEPH | GPH | GPHRYN | KIAA1385 | gephyrin | - | HPRD | 10900017 |
| HDAC5 | FLJ90614 | HD5 | NY-CO-9 | histone deacetylase 5 | Two-hybrid | BioGRID | 16169070 |
| NSF | SKD2 | N-ethylmaleimide-sensitive factor | - | HPRD | 11461150 |
| TFRC | CD71 | TFR | TFR1 | TRFR | transferrin receptor (p90, CD71) | - | HPRD,BioGRID | 11997026 |
| TUBB3 | MC1R | TUBB4 | beta-4 | tubulin, beta 3 | Two-hybrid | BioGRID | 16169070 |
| ULK1 | ATG1 | FLJ38455 | UNC51 | Unc51.1 | unc-51-like kinase 1 (C. elegans) | - | HPRD,BioGRID | 11146101 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG REGULATION OF AUTOPHAGY | 35 | 30 | All SZGR 2.0 genes in this pathway |
| BIOCARTA GABA PATHWAY | 10 | 10 | All SZGR 2.0 genes in this pathway |
| GARY CD5 TARGETS UP | 473 | 314 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE KERATINOCYTE UP | 530 | 342 | All SZGR 2.0 genes in this pathway |
| BERENJENO TRANSFORMED BY RHOA DN | 394 | 258 | All SZGR 2.0 genes in this pathway |
| LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
| KOYAMA SEMA3B TARGETS DN | 411 | 249 | All SZGR 2.0 genes in this pathway |
| BENPORATH MYC MAX TARGETS | 775 | 494 | All SZGR 2.0 genes in this pathway |
| BASSO B LYMPHOCYTE NETWORK | 143 | 96 | All SZGR 2.0 genes in this pathway |
| YAGI AML RELAPSE PROGNOSIS | 35 | 24 | All SZGR 2.0 genes in this pathway |
| PENG GLUCOSE DEPRIVATION DN | 169 | 112 | All SZGR 2.0 genes in this pathway |
| HASLINGER B CLL WITH 17P13 DELETION | 21 | 15 | All SZGR 2.0 genes in this pathway |
| YAGI AML SURVIVAL | 129 | 87 | All SZGR 2.0 genes in this pathway |
| MA PITUITARY FETAL VS ADULT DN | 19 | 17 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
| ALONSO METASTASIS UP | 198 | 128 | All SZGR 2.0 genes in this pathway |
| DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
| KARLSSON TGFB1 TARGETS DN | 207 | 139 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
| KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
| JOHNSTONE PARVB TARGETS 3 UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
| HUANG GATA2 TARGETS UP | 149 | 96 | All SZGR 2.0 genes in this pathway |
| KRIEG KDM3A TARGETS NOT HYPOXIA | 208 | 107 | All SZGR 2.0 genes in this pathway |
| FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
| MIZUSHIMA AUTOPHAGOSOME FORMATION | 19 | 15 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
| ZWANG EGF INTERVAL DN | 214 | 124 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-140 | 420 | 426 | m8 | hsa-miR-140brain | AGUGGUUUUACCCUAUGGUAG |
| miR-455 | 402 | 408 | m8 | hsa-miR-455 | UAUGUGCCUUUGGACUACAUCG |
| miR-542-3p | 262 | 268 | 1A | hsa-miR-542-3p | UGUGACAGAUUGAUAACUGAAA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.