Gene Page: GALNT13
Summary ?
| GeneID | 114805 |
| Symbol | GALNT13 |
| Synonyms | GalNAc-T13 |
| Description | polypeptide N-acetylgalactosaminyltransferase 13 |
| Reference | MIM:608369|HGNC:HGNC:23242|Ensembl:ENSG00000144278|HPRD:16325|Vega:OTTHUMG00000131917 |
| Gene type | protein-coding |
| Map location | 2q24.1 |
| Pascal p-value | 0.017 |
| Sherlock p-value | 0.507 |
| Fetal beta | -0.96 |
| DMG | 1 (# studies) |
| eGene | Cerebellum Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.02395 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg18311633 | 2 | 155309539 | GALNT13 | 7.69E-5 | 0.553 | 0.025 | DMG:Wockner_2014 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs17572651 | chr1 | 218943612 | GALNT13 | 114805 | 0.16 | trans | ||
| rs16829545 | chr2 | 151977407 | GALNT13 | 114805 | 0 | trans | ||
| rs7584986 | chr2 | 184111432 | GALNT13 | 114805 | 0.01 | trans | ||
| rs6807632 | chr3 | 111395567 | GALNT13 | 114805 | 0.14 | trans | ||
| rs1368303 | chr5 | 147672388 | GALNT13 | 114805 | 0.06 | trans | ||
| rs11846721 | chr14 | 63903555 | GALNT13 | 114805 | 0.02 | trans | ||
| rs16955618 | chr15 | 29937543 | GALNT13 | 114805 | 3.205E-7 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005529 | sugar binding | IEA | - | |
| GO:0005509 | calcium ion binding | IEA | - | |
| GO:0004653 | polypeptide N-acetylgalactosaminyltransferase activity | IEA | - | |
| GO:0016757 | transferase activity, transferring glycosyl groups | IEA | - | |
| GO:0030145 | manganese ion binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006493 | protein amino acid O-linked glycosylation | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0000139 | Golgi membrane | IEA | - | |
| GO:0005794 | Golgi apparatus | IEA | - | |
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG O GLYCAN BIOSYNTHESIS | 30 | 16 | All SZGR 2.0 genes in this pathway |
| REACTOME O LINKED GLYCOSYLATION OF MUCINS | 59 | 29 | All SZGR 2.0 genes in this pathway |
| REACTOME METABOLISM OF PROTEINS | 518 | 242 | All SZGR 2.0 genes in this pathway |
| REACTOME POST TRANSLATIONAL PROTEIN MODIFICATION | 188 | 116 | All SZGR 2.0 genes in this pathway |
| WANG CLIM2 TARGETS UP | 269 | 146 | All SZGR 2.0 genes in this pathway |
| ODONNELL TFRC TARGETS UP | 456 | 228 | All SZGR 2.0 genes in this pathway |
| ZHOU INFLAMMATORY RESPONSE FIMA UP | 544 | 308 | All SZGR 2.0 genes in this pathway |
| GAUSSMANN MLL AF4 FUSION TARGETS A DN | 90 | 61 | All SZGR 2.0 genes in this pathway |
| COLIN PILOCYTIC ASTROCYTOMA VS GLIOBLASTOMA UP | 35 | 32 | All SZGR 2.0 genes in this pathway |
| ZHANG GATA6 TARGETS UP | 15 | 12 | All SZGR 2.0 genes in this pathway |
| IWANAGA CARCINOGENESIS BY KRAS PTEN DN | 353 | 226 | All SZGR 2.0 genes in this pathway |
| WAGNER APO2 SENSITIVITY | 25 | 14 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 | 349 | 234 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN NPC HCP WITH H3K27ME3 | 341 | 243 | All SZGR 2.0 genes in this pathway |
| DURAND STROMA S UP | 297 | 194 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-218 | 187 | 193 | m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
| miR-455 | 189 | 195 | 1A | hsa-miR-455 | UAUGUGCCUUUGGACUACAUCG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.