Gene Page: CSF2
Summary ?
| GeneID | 1437 |
| Symbol | CSF2 |
| Synonyms | GMCSF |
| Description | colony stimulating factor 2 |
| Reference | MIM:138960|HGNC:HGNC:2434|Ensembl:ENSG00000164400|HPRD:00734|Vega:OTTHUMG00000059637 |
| Gene type | protein-coding |
| Map location | 5q31.1 |
| Pascal p-value | 0.288 |
| Fetal beta | 0.013 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.0032 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005125 | cytokine activity | IEA | - | |
| GO:0005129 | granulocyte macrophage colony-stimulating factor receptor binding | TAS | 2999978 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0043011 | myeloid dendritic cell differentiation | IEA | dendrite (GO term level: 10) | - |
| GO:0008284 | positive regulation of cell proliferation | IEA | - | |
| GO:0006955 | immune response | IEA | - | |
| GO:0042523 | positive regulation of tyrosine phosphorylation of Stat5 protein | IDA | 9722506 | |
| GO:0045740 | positive regulation of DNA replication | IDA | 9722506 | |
| GO:0045885 | positive regulation of survival gene product expression | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005576 | extracellular region | IEA | - | |
| GO:0005615 | extracellular space | IEA | - |
Section V. Pathway annotation
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-133 | 83 | 90 | 1A,m8 | hsa-miR-133a | UUGGUCCCCUUCAACCAGCUGU |
| hsa-miR-133b | UUGGUCCCCUUCAACCAGCUA | ||||
| miR-410 | 206 | 212 | 1A | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.