Gene Page: DGKH
Summary ?
| GeneID | 160851 |
| Symbol | DGKH |
| Synonyms | DGKeta |
| Description | diacylglycerol kinase eta |
| Reference | MIM:604071|HGNC:HGNC:2854|Ensembl:ENSG00000102780|HPRD:07237|Vega:OTTHUMG00000016804 |
| Gene type | protein-coding |
| Map location | 13q14.11 |
| Pascal p-value | 0.002 |
| Fetal beta | -0.161 |
| DMG | 2 (# studies) |
| eGene | Cerebellar Hemisphere |
| Support | Ascano FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 2 |
| DMG:Nishioka_2013 | Genome-wide DNA methylation analysis | The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. | 2 |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg00109274 | 13 | 42623032 | DGKH | -0.065 | 0.52 | DMG:Nishioka_2013 | |
| cg14555988 | 13 | 42623559 | DGKH | 4.32E-8 | -0.008 | 1.19E-5 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004143 | diacylglycerol kinase activity | IEA | - | |
| GO:0016740 | transferase activity | IEA | - | |
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0019992 | diacylglycerol binding | IEA | - | |
| GO:0046872 | metal ion binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007205 | activation of protein kinase C activity | IEA | - | |
| GO:0007242 | intracellular signaling cascade | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG GLYCEROLIPID METABOLISM | 49 | 26 | All SZGR 2.0 genes in this pathway |
| KEGG GLYCEROPHOSPHOLIPID METABOLISM | 77 | 35 | All SZGR 2.0 genes in this pathway |
| KEGG PHOSPHATIDYLINOSITOL SIGNALING SYSTEM | 76 | 56 | All SZGR 2.0 genes in this pathway |
| REACTOME GASTRIN CREB SIGNALLING PATHWAY VIA PKC AND MAPK | 205 | 136 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
| REACTOME G ALPHA Q SIGNALLING EVENTS | 184 | 116 | All SZGR 2.0 genes in this pathway |
| REACTOME GPCR DOWNSTREAM SIGNALING | 805 | 368 | All SZGR 2.0 genes in this pathway |
| REACTOME EFFECTS OF PIP2 HYDROLYSIS | 25 | 17 | All SZGR 2.0 genes in this pathway |
| REACTOME HEMOSTASIS | 466 | 331 | All SZGR 2.0 genes in this pathway |
| REACTOME PLATELET ACTIVATION SIGNALING AND AGGREGATION | 208 | 138 | All SZGR 2.0 genes in this pathway |
| LINDGREN BLADDER CANCER CLUSTER 3 DN | 229 | 142 | All SZGR 2.0 genes in this pathway |
| FOSTER TOLERANT MACROPHAGE DN | 409 | 268 | All SZGR 2.0 genes in this pathway |
| ACEVEDO LIVER CANCER WITH H3K9ME3 DN | 120 | 71 | All SZGR 2.0 genes in this pathway |
| FIRESTEIN CTNNB1 PATHWAY | 33 | 23 | All SZGR 2.0 genes in this pathway |
| ROME INSULIN TARGETS IN MUSCLE DN | 204 | 114 | All SZGR 2.0 genes in this pathway |
| RAO BOUND BY SALL4 | 227 | 149 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-135 | 201 | 207 | m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
| hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
| miR-29 | 8 | 15 | 1A,m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
| hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
| hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
| miR-363 | 217 | 223 | 1A | hsa-miR-363 | AUUGCACGGUAUCCAUCUGUAA |
| miR-452 | 218 | 224 | m8 | hsa-miR-452 | UGUUUGCAGAGGAAACUGAGAC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.