SZGR2

Summary ?

GeneID	1742
Symbol	DLG4
Synonyms	PSD95\|SAP-90\|SAP90
Description	discs large homolog 4
Reference	MIM:602887\|HGNC:HGNC:2903\|Ensembl:ENSG00000132535\|HPRD:04199\|Vega:OTTHUMG00000134327
Gene type	protein-coding
Map location	17p13.1
Pascal p-value	1.301E-4
Fetal beta	-0.465
DMG	1 (# studies)
eGene	Meta
Support	PROTEIN CLUSTERING G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.human_clathrin G2Cdb.human_PocklingtonH1 G2Cdb.human_Synaptosome G2Cdb.human_TAP-PSD-95-CORE G2Cdb.humanNRC G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets Potential synaptic genes

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 7
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 7.5711

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg04106389	17	7117241	DLG4	2.334E-4	0.308	0.037	DMG:Wockner_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IEA		-
GO:0008022	protein C-terminus binding	IPI		7477295
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0016188	synaptic vesicle maturation	IEA	Synap (GO term level: 8)	-
GO:0007268	synaptic transmission	TAS	neuron, Synap, Neurotransmitter (GO term level: 6)	9853749
GO:0048169	regulation of long-term neuronal synaptic plasticity	IEA	neuron, Synap (GO term level: 10)	-
GO:0007399	nervous system development	TAS	neurite (GO term level: 5)	9286702
GO:0006461	protein complex assembly	TAS		7477295
GO:0007165	signal transduction	TAS		10364559
GO:0007612	learning	TAS		9853749
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0014069	postsynaptic density	IEA	Synap (GO term level: 10)	-
GO:0019717	synaptosome	IEA	Synap, Brain (GO term level: 7)	-
GO:0045211	postsynaptic membrane	IDA	Synap, Neurotransmitter (GO term level: 5)	12151521
GO:0045202	synapse	IEA	neuron, Synap, Neurotransmitter, Glial (GO term level: 2)	-
GO:0005737	cytoplasm	IEA		-
GO:0005886	plasma membrane	IEA		-
GO:0030054	cell junction	IEA		-
GO:0031234	extrinsic to internal side of plasma membrane	IEA		-
GO:0030863	cortical cytoskeleton	IDA		12151521

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ACCN3	ASIC3 \| DRASIC \| SLNAC1 \| TNaC1	amiloride-sensitive cation channel 3	ASIC3 interacts with DLG4 (PSD-95). This interaction was modeled on a demonstrated interaction between mouse or rat ASIC3 and rat DLG4 (PSD-95).	BIND	15317815
ACCN3	ASIC3 \| DRASIC \| SLNAC1 \| TNaC1	amiloride-sensitive cation channel 3	-	HPRD,BioGRID	15317815
ACTN2	CMD1AA	actinin, alpha 2	-	HPRD,BioGRID	12435606
ADAM22	MDC2 \| MGC149832	ADAM metallopeptidase domain 22	Affinity Capture-MS Affinity Capture-Western	BioGRID	16990550
ADRB1	ADRB1R \| B1AR \| BETA1AR \| RHR	adrenergic, beta-1-, receptor	-	HPRD,BioGRID	10995758
AKAP5	AKAP75 \| AKAP79 \| H21	A kinase (PRKA) anchor protein 5	-	HPRD	10939335
ATP2B2	PMCA2 \| PMCA2a \| PMCA2i	ATPase, Ca++ transporting, plasma membrane 2	-	HPRD	11274188
ATP2B2	PMCA2 \| PMCA2a \| PMCA2i	ATPase, Ca++ transporting, plasma membrane 2	PMCA2b interacts with SAP90. This interaction was modeled on a demonstrated interaction between human PMCA2b and rat SAP90.	BIND	11274188
ATP2B4	ATP2B2 \| DKFZp686G08106 \| DKFZp686M088 \| MXRA1 \| PMCA4 \| PMCA4b \| PMCA4x	ATPase, Ca++ transporting, plasma membrane 4	PMCA4b interacts with PSD-95.	BIND	9430700
ATP2B4	ATP2B2 \| DKFZp686G08106 \| DKFZp686M088 \| MXRA1 \| PMCA4 \| PMCA4b \| PMCA4x	ATPase, Ca++ transporting, plasma membrane 4	-	HPRD	11274188
BAI1	FLJ41988	brain-specific angiogenesis inhibitor 1	-	HPRD,BioGRID	11937501
BEGAIN	KIAA1446	brain-enriched guanylate kinase-associated homolog (rat)	-	HPRD	9756850
CACNG2	MGC138502 \| MGC138504	calcium channel, voltage-dependent, gamma subunit 2	-	HPRD,BioGRID	11805122
CASK	CAGH39 \| CMG \| FLJ22219 \| FLJ31914 \| LIN2 \| MICPCH \| TNRC8	calcium/calmodulin-dependent serine protein kinase (MAGUK family)	-	HPRD,BioGRID	12151521
CD46	MCP \| MGC26544 \| MIC10 \| TLX \| TRA2.10	CD46 molecule, complement regulatory protein	-	HPRD,BioGRID	11714708
CIT	CRIK \| KIAA0949 \| STK21	citron (rho-interacting, serine/threonine kinase 21)	in vivo Two-hybrid	BioGRID	9870942
CRIPT	HSPC139	cysteine-rich PDZ-binding protein	-	HPRD,BioGRID	9581762
DAP	MGC99796	death-associated protein	-	HPRD	9286858
DLG1	DKFZp761P0818 \| DKFZp781B0426 \| DLGH1 \| SAP97 \| dJ1061C18.1.1 \| hdlg	discs, large homolog 1 (Drosophila)	Affinity Capture-Western	BioGRID	9286858
DLG2	DKFZp781D1854 \| DKFZp781E0954 \| FLJ37266 \| MGC131811 \| PSD-93	discs, large homolog 2, chapsyn-110 (Drosophila)	-	HPRD,BioGRID	9182804
DLG3	KIAA1232 \| MRX \| MRX90 \| NE-Dlg \| NEDLG \| SAP102	discs, large homolog 3 (neuroendocrine-dlg, Drosophila)	-	HPRD,BioGRID	10026200
DLG4	FLJ97752 \| FLJ98574 \| PSD95 \| SAP90	discs, large homolog 4 (Drosophila)	Affinity Capture-Western	BioGRID	9182804
DLGAP1	DAP-1 \| DAP-1-ALPHA \| DAP-1-BETA \| GKAP \| MGC88156 \| SAPAP1 \| hGKAP	discs, large (Drosophila) homolog-associated protein 1	Affinity Capture-Western Co-fractionation Far Western Reconstituted Complex Two-hybrid	BioGRID	9024696 \|9115257 \|9286858 \|10527873 \|10844022 \|11060025
DLGAP1	DAP-1 \| DAP-1-ALPHA \| DAP-1-BETA \| GKAP \| MGC88156 \| SAPAP1 \| hGKAP	discs, large (Drosophila) homolog-associated protein 1	-	HPRD	9024696 \|9286858
DLGAP1	DAP-1 \| DAP-1-ALPHA \| DAP-1-BETA \| GKAP \| MGC88156 \| SAPAP1 \| hGKAP	discs, large (Drosophila) homolog-associated protein 1	PSD-95 interacts with DAP-1alpha.	BIND	9286858
DLGAP2	DAP2 \| SAPAP2	discs, large (Drosophila) homolog-associated protein 2	-	HPRD	9286858
DLGAP2	DAP2 \| SAPAP2	discs, large (Drosophila) homolog-associated protein 2	Reconstituted Complex Two-hybrid	BioGRID	9115257
DLGAP3	DAP3 \| SAPAP3	discs, large (Drosophila) homolog-associated protein 3	Two-hybrid	BioGRID	9115257
DLGAP4	DAP4 \| KIAA0964 \| MGC131862 \| RP5-977B1.6 \| SAPAP4	discs, large (Drosophila) homolog-associated protein 4	Two-hybrid	BioGRID	9115257
DYNLL1	DLC1 \| DLC8 \| DNCL1 \| DNCLC1 \| LC8 \| LC8a \| MGC126137 \| MGC126138 \| PIN \| hdlc1	dynein, light chain, LC8-type 1	Affinity Capture-Western Reconstituted Complex	BioGRID	10844022
DYNLL1	DLC1 \| DLC8 \| DNCL1 \| DNCLC1 \| LC8 \| LC8a \| MGC126137 \| MGC126138 \| PIN \| hdlc1	dynein, light chain, LC8-type 1	-	HPRD	14760703
DYNLL2	DNCL1B \| Dlc2 \| MGC17810	dynein, light chain, LC8-type 2	-	HPRD,BioGRID	10844022
ERBB2	CD340 \| HER-2 \| HER-2/neu \| HER2 \| NEU \| NGL \| TKR1	v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)	-	HPRD,BioGRID	10839362
ERBB2IP	ERBIN \| LAP2	erbb2 interacting protein	-	HPRD,BioGRID	11279080
ERBB4	HER4 \| MGC138404 \| p180erbB4	v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian)	-	HPRD,BioGRID	10725395
ERBB4	HER4 \| MGC138404 \| p180erbB4	v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian)	ErbB-4 interacts with PSD-95.	BIND	10725395
EXOC4	MGC27170 \| REC8 \| SEC8 \| SEC8L1 \| Sec8p	exocyst complex component 4	Affinity Capture-Western Reconstituted Complex	BioGRID	12675619 \|12738960
FYN	MGC45350 \| SLK \| SYN	FYN oncogene related to SRC, FGR, YES	-	HPRD,BioGRID	12419528
FZD1	DKFZp564G072	frizzled homolog 1 (Drosophila)	-	HPRD,BioGRID	12067714
FZD2	-	frizzled homolog 2 (Drosophila)	Two-hybrid	BioGRID	12067714
FZD4	CD344 \| EVR1 \| FEVR \| FZD4S \| Fz-4 \| FzE4 \| GPCR \| MGC34390	frizzled homolog 4 (Drosophila)	-	HPRD,BioGRID	12067714
FZD7	FzE3	frizzled homolog 7 (Drosophila)	Affinity Capture-Western Two-hybrid	BioGRID	12067714
GDA	CYPIN \| GUANASE \| KIAA1258 \| MGC9982 \| NEDASIN	guanine deaminase	-	HPRD	10595517
GRIA2	GLUR2 \| GLURB \| GluR-K2 \| HBGR2	glutamate receptor, ionotropic, AMPA 2	Affinity Capture-MS	BioGRID	16990550
GRIA3	GLUR-C \| GLUR-K3 \| GLUR3 \| GLURC \| MRX94	glutamate receptor, ionotrophic, AMPA 3	Affinity Capture-MS	BioGRID	16990550
GRIK1	EAA3 \| EEA3 \| GLR5 \| GLUR5	glutamate receptor, ionotropic, kainate 1	-	HPRD,BioGRID	12597860
GRIK2	EAA4 \| GLR6 \| GLUK6 \| GLUR6 \| MGC74427 \| MRT6	glutamate receptor, ionotropic, kainate 2	-	HPRD	9808460 \|11276111 \|12597860
GRIK2	EAA4 \| GLR6 \| GLUK6 \| GLUR6 \| MGC74427 \| MRT6	glutamate receptor, ionotropic, kainate 2	Affinity Capture-Western Reconstituted Complex	BioGRID	9808460 \|11279111 \|12597860
GRIK5	EAA2 \| GRIK2 \| KA2	glutamate receptor, ionotropic, kainate 5	-	HPRD,BioGRID	9808460 \|11279111
GRIN1	NMDA1 \| NMDAR1 \| NR1	glutamate receptor, ionotropic, N-methyl D-aspartate 1	-	HPRD	9009191 \|9502803 \|11506858 \|12068077 \|14732708 \|15030493
GRIN2A	NMDAR2A \| NR2A	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	-	HPRD	7569905 \|11937501 \|12419528
GRIN2A	NMDAR2A \| NR2A	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	Affinity Capture-Western in vitro in vivo Reconstituted Complex Two-hybrid	BioGRID	7569905 \|9278515 \|9286858 \|10648730 \|11937501 \|12419528
GRIN2B	MGC142178 \| MGC142180 \| NMDAR2B \| NR2B \| hNR3	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	Affinity Capture-Western in vitro in vivo Reconstituted Complex Two-hybrid	BioGRID	7569905 \|9278515 \|9581762 \|11937501 \|11997254 \|12738960
GRIN2B	MGC142178 \| MGC142180 \| NMDAR2B \| NR2B \| hNR3	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	-	HPRD	7569905 \|9581762\|11937501
GRIN2C	NMDAR2C \| NR2C	glutamate receptor, ionotropic, N-methyl D-aspartate 2C	-	HPRD,BioGRID	7569905 \|11937501
GRIN2D	EB11 \| NMDAR2D	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	-	HPRD,BioGRID	7569905
GRIN3A	FLJ45414 \| NMDAR-L \| NR3A	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	in vitro in vivo Two-hybrid	BioGRID	7569905
GRIN3B	NR3B	glutamate receptor, ionotropic, N-methyl-D-aspartate 3B	in vitro in vivo Two-hybrid	BioGRID	7569905
GUCY1A2	GC-SA2 \| GUC1A2	guanylate cyclase 1, soluble, alpha 2	-	HPRD,BioGRID	11572861
HGS	HRS \| ZFYVE8	hepatocyte growth factor-regulated tyrosine kinase substrate	-	HPRD,BioGRID	12151521
HTR2A	5-HT2A \| HTR2	5-hydroxytryptamine (serotonin) receptor 2A	-	HPRD,BioGRID	12682061
HTR2C	5-HT2C \| 5-HTR2C \| HTR1C	5-hydroxytryptamine (serotonin) receptor 2C	-	HPRD,BioGRID	12006486
HTT	HD \| IT15	huntingtin	Huntingtin interacts with PSD-95.	BIND	11319238
IL13RA1	CD213A1 \| IL-13Ra \| NR4	interleukin 13 receptor, alpha 1	in vitro in vivo Two-hybrid	BioGRID	7569905
KCNA1	AEMK \| EA1 \| HBK1 \| HUK1 \| KV1.1 \| MBK1 \| MGC126782 \| MGC138385 \| MK1 \| RBK1	potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)	Reconstituted Complex Two-hybrid	BioGRID	12435606
KCNA2	HBK5 \| HK4 \| HUKIV \| KV1.2 \| MGC50217 \| MK2 \| NGK1 \| RBK2	potassium voltage-gated channel, shaker-related subfamily, member 2	-	HPRD,BioGRID	8938729 \|12435606
KCNA4	HBK4 \| HK1 \| HPCN2 \| HUKII \| KCNA4L \| KCNA8 \| KV1.4 \| PCN2	potassium voltage-gated channel, shaker-related subfamily, member 4	-	HPRD	8938729 \|9581762 \|12435606
KCNA4	HBK4 \| HK1 \| HPCN2 \| HUKII \| KCNA4L \| KCNA8 \| KV1.4 \| PCN2	potassium voltage-gated channel, shaker-related subfamily, member 4	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	8938729 \|9581762 \|11997254 \|12435606
KCNA5	ATFB7 \| HCK1 \| HK2 \| HPCN1 \| KV1.5 \| MGC117058 \| MGC117059 \| PCN1	potassium voltage-gated channel, shaker-related subfamily, member 5	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	12435606 \|12860415
KCND2	KIAA1044 \| KV4.2 \| MGC119702 \| MGC119703 \| RK5	potassium voltage-gated channel, Shal-related subfamily, member 2	Two-hybrid	BioGRID	12435606
KCNJ10	BIRK-10 \| KCNJ13-PEN \| KIR1.2 \| KIR4.1	potassium inwardly-rectifying channel, subfamily J, member 10	-	HPRD	9148889
KCNJ12	FLJ14167 \| IRK2 \| KCNJN1 \| Kir2.2 \| Kir2.2v \| hIRK \| hIRK1 \| hkir2.2x \| kcnj12x	potassium inwardly-rectifying channel, subfamily J, member 12	-	HPRD,BioGRID	15024025
KCNJ2	HHBIRK1 \| HHIRK1 \| IRK1 \| KIR2.1 \| LQT7 \| SQT3	potassium inwardly-rectifying channel, subfamily J, member 2	-	HPRD,BioGRID	10627592
KCNJ4	HIR \| HIRK2 \| HRK1 \| IRK3 \| Kir2.3 \| MGC142066 \| MGC142068	potassium inwardly-rectifying channel, subfamily J, member 4	Affinity Capture-Western Two-hybrid	BioGRID	10627592 \|11997254 \|14960569
KIF13B	GAKIN \| KIAA0639	kinesin family member 13B	-	HPRD,BioGRID	10859302
KIF1B	CMT2 \| CMT2A \| CMT2A1 \| FLJ23699 \| HMSNII \| KIAA0591 \| KIAA1448 \| KLP \| MGC134844	kinesin family member 1B	-	HPRD	12097473
LGI1	EPITEMPIN \| EPT \| ETL1 \| IB1099	leucine-rich, glioma inactivated 1	Affinity Capture-MS Affinity Capture-Western	BioGRID	16990550
LIN7A	LIN-7A \| LIN7 \| MALS-1 \| MGC148143 \| TIP-33 \| VELI1	lin-7 homolog A (C. elegans)	-	HPRD,BioGRID	10341223
LIN7B	LIN-7B \| MALS-2 \| MALS2 \| VELI2	lin-7 homolog B (C. elegans)	in vivo	BioGRID	10341223
LRP1	A2MR \| APOER \| APR \| CD91 \| FLJ16451 \| IGFBP3R \| LRP \| MGC88725 \| TGFBR5	low density lipoprotein-related protein 1 (alpha-2-macroglobulin receptor)	-	HPRD,BioGRID	10827173
LRP2	DBS \| gp330	low density lipoprotein-related protein 2	-	HPRD,BioGRID	12713445
LRP8	APOER2 \| HSZ75190 \| MCI1	low density lipoprotein receptor-related protein 8, apolipoprotein e receptor	Two-hybrid	BioGRID	10827173
LRRC1	FLJ10775 \| FLJ11834 \| LANO \| dJ523E19.1	leucine rich repeat containing 1	-	HPRD,BioGRID	11440998
LRRC7	DKFZp686I1147 \| KIAA1365 \| MGC144918	leucine rich repeat containing 7	Affinity Capture-Western	BioGRID	12390249
LYN	FLJ26625 \| JTK8	v-yes-1 Yamaguchi sarcoma viral related oncogene homolog	-	HPRD	9892651
MAP1A	FLJ77111 \| MAP1L \| MTAP1A	microtubule-associated protein 1A	-	HPRD,BioGRID	9786987 \|11925566
MAP3K10	MLK2 \| MST	mitogen-activated protein kinase kinase kinase 10	-	HPRD,BioGRID	11152698
MAP3K11	MGC17114 \| MLK-3 \| MLK3 \| PTK1 \| SPRK	mitogen-activated protein kinase kinase kinase 11	Affinity Capture-Western	BioGRID	11152698
NDOR1	MGC138148 \| NR1 \| bA350O14.9	NADPH dependent diflavin oxidoreductase 1	-	HPRD,BioGRID	7569905
NLGN1	KIAA1070 \| MGC45115	neuroligin 1	Reconstituted Complex Two-hybrid	BioGRID	9278515
NLGN2	KIAA1366	neuroligin 2	Two-hybrid	BioGRID	9278515
NLGN3	ASPGX1 \| AUTSX1 \| HNL3 \| KIAA1480	neuroligin 3	-	HPRD,BioGRID	9278515
NLGN4X	ASPGX2 \| AUTSX2 \| HLNX \| HNLX \| KIAA1260 \| MGC22376 \| NLGN \| NLGN4	neuroligin 4, X-linked	-	HPRD,BioGRID	11368788
NOS1	IHPS1 \| NOS \| nNOS	nitric oxide synthase 1 (neuronal)	-	HPRD,BioGRID	8625413
NRG1	ARIA \| GGF \| GGF2 \| HGL \| HRG \| HRG1 \| HRGA \| NDF \| SMDF	neuregulin 1	Nrg-1 interacts with PSD-95 promoter. This interaction was modeled on a demonstrated interaction between Nrg-1 from an unspecified species and human PSD-95 promoter.	BIND	15494726
PARK2	AR-JP \| LPRS2 \| PDJ \| PRKN	Parkinson disease (autosomal recessive, juvenile) 2, parkin	Affinity Capture-Western	BioGRID	11679592
PRKCA	AAG6 \| MGC129900 \| MGC129901 \| PKC-alpha \| PKCA \| PRKACA	protein kinase C, alpha	-	HPRD,BioGRID	11937501
PTK2B	CADTK \| CAKB \| FADK2 \| FAK2 \| FRNK \| PKB \| PTK \| PYK2 \| RAFTK	PTK2B protein tyrosine kinase 2 beta	-	HPRD,BioGRID	12576483
PTPRG	HPTPG \| PTPG \| R-PTP-GAMMA \| RPTPG	protein tyrosine phosphatase, receptor type, G	-	HPRD,BioGRID	10521598
RICS	GC-GAP \| GRIT \| KIAA0712 \| MGC1892 \| p200RhoGAP \| p250GAP	Rho GTPase-activating protein	-	HPRD	12531901
SEMA4C	FLJ20369 \| KIAA1739 \| M-SEMA-F \| MGC126382 \| MGC126383 \| SEMACL1 \| SEMAF \| SEMAI	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C	-	HPRD,BioGRID	11134026
SEMA4F	M-SEMA \| PRO2353 \| SEMAM \| SEMAW \| m-Sema-M	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F	-	HPRD,BioGRID	11483650
SHANK1	SPANK-1 \| SSTRIP \| synamon	SH3 and multiple ankyrin repeat domains 1	-	HPRD,BioGRID	10433268
SHANK2	CORTBP1 \| CTTNBP1 \| ProSAP1 \| SHANK \| SPANK-3	SH3 and multiple ankyrin repeat domains 2	-	HPRD,BioGRID	10527873
SIPA1L1	DKFZp686G1344 \| E6TP1 \| KIAA0440	signal-induced proliferation-associated 1 like 1	-	HPRD,BioGRID	11502259
SYNGAP1	DKFZp761G1421 \| KIAA1938 \| RASA1 \| RASA5 \| SYNGAP	synaptic Ras GTPase activating protein 1 homolog (rat)	Two-hybrid	BioGRID	9581761
TANC1	KIAA1728 \| ROLSB \| TANC	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	-	HPRD	15673434
YES1	HsT441 \| P61-YES \| Yes \| c-yes	v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1	-	HPRD	9892651
ZDHHC17	HIP14 \| HIP3 \| HSPC294 \| HYPH \| KIAA0946	zinc finger, DHHC-type containing 17	HIP14 catalyzes palmitoylation of PSD-95. This interaction was modeled on a demonstrated interaction between human HIP14 and PSD-95 from an unspecified species.	BIND	15603740

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG HUNTINGTONS DISEASE	185	109	All SZGR 2.0 genes in this pathway
BIOCARTA NOS1 PATHWAY	24	21	All SZGR 2.0 genes in this pathway
ST GA12 PATHWAY	23	16	All SZGR 2.0 genes in this pathway
ST GA13 PATHWAY	37	32	All SZGR 2.0 genes in this pathway
ST MYOCYTE AD PATHWAY	27	25	All SZGR 2.0 genes in this pathway
PID ERBB4 PATHWAY	38	32	All SZGR 2.0 genes in this pathway
PEREZ TP63 TARGETS	355	243	All SZGR 2.0 genes in this pathway
WATTEL AUTONOMOUS THYROID ADENOMA UP	73	47	All SZGR 2.0 genes in this pathway
SHETH LIVER CANCER VS TXNIP LOSS PAM2	153	102	All SZGR 2.0 genes in this pathway
STARK PREFRONTAL CORTEX 22Q11 DELETION UP	195	138	All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST UP	398	262	All SZGR 2.0 genes in this pathway
JIANG AGING HYPOTHALAMUS DN	40	31	All SZGR 2.0 genes in this pathway
MCCLUNG COCAINE REWARD 5D	79	62	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 18HR UP	178	111	All SZGR 2.0 genes in this pathway
RAMPON ENRICHED LEARNING ENVIRONMENT LATE UP	22	16	All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP	566	371	All SZGR 2.0 genes in this pathway
LEIN LOCALIZED TO DISTAL AND PROXIMAL DENDRITES	17	12	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 60HR DN	277	166	All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER GOOD SURVIVAL A12	317	177	All SZGR 2.0 genes in this pathway
MIKKELSEN ES ICP WITH H3K4ME3	718	401	All SZGR 2.0 genes in this pathway
MIKKELSEN NPC ICP WITH H3K4ME3	445	257	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 1HR DN	222	147	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 36HR	152	88	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D	882	506	All SZGR 2.0 genes in this pathway
ABDELMOHSEN ELAVL4 TARGETS	16	13	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-1/206	339	346	1A,m8	hsa-miR-1	UGGAAUGUAAAGAAGUAUGUA
				hsa-miR-206^SZ	UGGAAUGUAAGGAAGUGUGUGG
				hsa-miR-613	AGGAAUGUUCCUUCUUUGCC
miR-103/107	747	753	m8	hsa-miR-103^brain	AGCAGCAUUGUACAGGGCUAUGA
miR-103/107	747	753	m8	hsa-miR-107^brain	AGCAGCAUUGUACAGGGCUAUCA
miR-122	154	160	m8	hsa-miR-122a	UGGAGUGUGACAAUGGUGUUUGU
miR-149	728	734	m8	hsa-miR-149^brain	UCUGGCUCCGUGUCUUCACUCC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: DLG4