SZGR2

Summary ?

GeneID	1856
Symbol	DVL2
Synonyms	-
Description	dishevelled segment polarity protein 2
Reference	MIM:602151\|HGNC:HGNC:3086\|Ensembl:ENSG00000004975\|HPRD:03690\|Vega:OTTHUMG00000102155
Gene type	protein-coding
Map location	17p13.1
Pascal p-value	1.528E-4
Sherlock p-value	0.274
Fetal beta	0.361
DMG	2 (# studies)

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:vanEijk_2014	Genome-wide DNA methylation analysis	This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250).	2
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	2
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.1522

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg13248847	17	7137857	DVL2	3.88E-5	-0.212	0.02	DMG:Wockner_2014
cg11181795	17	7219971	DVL2	3.03E-4	-4.25		DMG:vanEijk_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004871	signal transducer activity	TAS		8887313
GO:0042802	identical protein binding	IPI		16189514
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0001843	neural tube closure	IEA		-
GO:0016055	Wnt receptor signaling pathway	IEA		-
GO:0007379	segment specification	IEA		-
GO:0007242	intracellular signaling cascade	IEA		-
GO:0007507	heart development	IEA		-
GO:0007447	imaginal disc pattern formation	TAS		8887313
GO:0007275	multicellular organismal development	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005622	intracellular	IEA		-
GO:0005737	cytoplasm	TAS		9192851

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
AP1M1	AP47 \| CLAPM2 \| CLTNM \| MU-1A	adaptor-related protein complex 1, mu 1 subunit	Two-hybrid	BioGRID	16189514
AP2M1	AP50 \| CLAPM1 \| mu2	adaptor-related protein complex 2, mu 1 subunit	Two-hybrid	BioGRID	16189514
ARR3	ARRX	arrestin 3, retinal (X-arrestin)	Two-hybrid	BioGRID	16189514
ARRB1	ARB1 \| ARR1	arrestin, beta 1	-	HPRD,BioGRID	11742073
AXIN1	AXIN \| MGC52315	axin 1	-	HPRD,BioGRID	10829020
BAG3	BAG-3 \| BIS \| CAIR-1 \| MGC104307	BCL2-associated athanogene 3	Two-hybrid	BioGRID	16189514
BAHD1	KIAA0945	bromo adjacent homology domain containing 1	Two-hybrid	BioGRID	16189514
C16orf48	DAKV6410 \| DKFZp434A1319	chromosome 16 open reading frame 48	Two-hybrid	BioGRID	16189514
C9orf100	FLJ14642 \| MGC44886 \| RP11-331F9.7	chromosome 9 open reading frame 100	Two-hybrid	BioGRID	16189514
CCDC33	FLJ23168 \| FLJ32855 \| MGC34145	coiled-coil domain containing 33	Two-hybrid	BioGRID	16189514
CSNK1E	HCKIE \| MGC10398	casein kinase 1, epsilon	Two-hybrid	BioGRID	16189514
CSNK2A1	CK2A1 \| CKII	casein kinase 2, alpha 1 polypeptide	Affinity Capture-Western	BioGRID	10806215
CTNNB1	CTNNB \| DKFZp686D02253 \| FLJ25606 \| FLJ37923	catenin (cadherin-associated protein), beta 1, 88kDa	Affinity Capture-Western	BioGRID	10806215
DAB2	DOC-2 \| DOC2 \| FLJ26626	disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)	Affinity Capture-Western Reconstituted Complex	BioGRID	12805222
DDI1	FLJ36017	DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae)	Two-hybrid	BioGRID	16189514
DPPA2	PESCRG1	developmental pluripotency associated 2	Two-hybrid	BioGRID	16189514
DVL2	-	dishevelled, dsh homolog 2 (Drosophila)	Affinity Capture-Western Two-hybrid	BioGRID	16189514
FAM105B	FLJ34884	family with sequence similarity 105, member B	Two-hybrid	BioGRID	16189514
FLJ12529	FLJ39024 \| MGC9315	pre-mRNA cleavage factor I, 59 kDa subunit	Two-hybrid	BioGRID	16189514
MAP3K1	MAPKKK1 \| MEKK \| MEKK1	mitogen-activated protein kinase kinase kinase 1	Affinity Capture-Western	BioGRID	10829020
MCRS1	ICP22BP \| INO80Q \| MCRS2 \| MSP58 \| P78	microspherule protein 1	Two-hybrid	BioGRID	16189514
PCBD1	DCOH \| PCBD \| PCD \| PHS	pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha	Two-hybrid	BioGRID	16189514
POLI	RAD30B \| RAD3OB	polymerase (DNA directed) iota	Two-hybrid	BioGRID	16189514
PRPF3	HPRP3 \| HPRP3P \| PRP3 \| Prp3p \| RP18	PRP3 pre-mRNA processing factor 3 homolog (S. cerevisiae)	Two-hybrid	BioGRID	16189514
RBPMS	HERMES	RNA binding protein with multiple splicing	Two-hybrid	BioGRID	16189514
RHOXF2	PEPP-2 \| PEPP2 \| THG1	Rhox homeobox family, member 2	Two-hybrid	BioGRID	16189514
RNPS1	E5.1 \| MGC117332	RNA binding protein S1, serine-rich domain	Two-hybrid	BioGRID	16189514
SNF8	Dot3 \| EAP30 \| VPS22	SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae)	Two-hybrid	BioGRID	16189514
SNIP1	FLJ12553 \| RP3-423B22.3 \| dJ423B22.2	Smad nuclear interacting protein 1	Two-hybrid	BioGRID	16189514
SORBS3	SCAM-1 \| SCAM1 \| SH3D4 \| VINEXIN	sorbin and SH3 domain containing 3	Two-hybrid	BioGRID	16189514
TCEB3B	ELOA2 \| HsT832 \| MGC119351 \| TCEB3L	transcription elongation factor B polypeptide 3B (elongin A2)	Two-hybrid	BioGRID	16189514
THAP1	FLJ10477 \| MGC33014	THAP domain containing, apoptosis associated protein 1	Two-hybrid	BioGRID	16189514
TIFA	MGC20791 \| T2BP \| T6BP \| TIFAA	TRAF-interacting protein with forkhead-associated domain	Two-hybrid	BioGRID	16189514
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	Two-hybrid	BioGRID	16189514
TRAF2	MGC:45012 \| TRAP \| TRAP3	TNF receptor-associated factor 2	Two-hybrid	BioGRID	16189514
U2AF2	U2AF65	U2 small nuclear RNA auxiliary factor 2	Two-hybrid	BioGRID	16189514
USP5	ISOT	ubiquitin specific peptidase 5 (isopeptidase T)	Two-hybrid	BioGRID	16189514
VANGL1	LPP2 \| MGC5338 \| STB2 \| STBM2	vang-like 1 (van gogh, Drosophila)	-	HPRD	15456783
ZBTB8	BOZF1 \| FLJ90065 \| MGC17919	zinc finger and BTB domain containing 8	Two-hybrid	BioGRID	16189514
ZNF165	LD65 \| ZSCAN7	zinc finger protein 165	Affinity Capture-Western Two-hybrid	BioGRID	16189514
ZNF250	FLJ57354 \| MGC111123 \| MGC9718 \| ZFP647 \| ZNF647	zinc finger protein 250	Two-hybrid	BioGRID	16189514
ZNF263	FPM315 \| ZKSCAN12	zinc finger protein 263	Two-hybrid	BioGRID	16189514

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG WNT SIGNALING PATHWAY	151	112	All SZGR 2.0 genes in this pathway
KEGG NOTCH SIGNALING PATHWAY	47	35	All SZGR 2.0 genes in this pathway
KEGG MELANOGENESIS	102	80	All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER	328	259	All SZGR 2.0 genes in this pathway
KEGG BASAL CELL CARCINOMA	55	44	All SZGR 2.0 genes in this pathway
WNT SIGNALING	89	71	All SZGR 2.0 genes in this pathway
PID WNT NONCANONICAL PATHWAY	32	26	All SZGR 2.0 genes in this pathway
PID BETA CATENIN DEG PATHWAY	18	17	All SZGR 2.0 genes in this pathway
PID WNT CANONICAL PATHWAY	20	18	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY HIPPO	22	15	All SZGR 2.0 genes in this pathway
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN	663	425	All SZGR 2.0 genes in this pathway
PATIL LIVER CANCER	747	453	All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS	988	594	All SZGR 2.0 genes in this pathway
BENPORATH SOX2 TARGETS	734	436	All SZGR 2.0 genes in this pathway
SAKAI CHRONIC HEPATITIS VS LIVER CANCER DN	36	24	All SZGR 2.0 genes in this pathway
SHIN B CELL LYMPHOMA CLUSTER 1	13	11	All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS	882	572	All SZGR 2.0 genes in this pathway
HU GENOTOXIN ACTION DIRECT VS INDIRECT 4HR	37	22	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 4	307	185	All SZGR 2.0 genes in this pathway
VART KSHV INFECTION ANGIOGENIC MARKERS DN	138	92	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 36HR UP	221	150	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 UP	430	288	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-128	126	133	1A,m8	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	126	133	1A,m8	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-138	138	145	1A,m8	hsa-miR-138^brain	AGCUGGUGUUGUGAAUC
miR-27	127	133	m8	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	127	133	m8	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-495	460	466	1A	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: DVL2