Gene Page: PTK2B
Summary ?
GeneID | 2185 |
Symbol | PTK2B |
Synonyms | CADTK|CAKB|FADK2|FAK2|PKB|PTK|PYK2|RAFTK |
Description | protein tyrosine kinase 2 beta |
Reference | MIM:601212|HGNC:HGNC:9612|Ensembl:ENSG00000120899|HPRD:03131|Vega:OTTHUMG00000102082 |
Gene type | protein-coding |
Map location | 8p21.1 |
Pascal p-value | 0.003 |
Sherlock p-value | 0.278 |
TADA p-value | 0.018 |
Fetal beta | -1.84 |
DMG | 2 (# studies) |
Support | G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.humanNRC G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets Potential synaptic genes |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 2 |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
DNM:Fromer_2014 | Whole Exome Sequencing analysis | This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA. | |
DNM:McCarthy_2014 | Whole Exome Sequencing analysis | Whole exome sequencing of 57 trios with sporadic or familial schizophrenia. | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_I | Genome scan meta-analysis | Psr: 0.031 | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.00057 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.03086 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.5281 |
Section I. Genetics and epigenetics annotation
DNM table
Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
---|---|---|---|---|---|---|---|---|---|---|---|
PTK2B | chr8 | 27308409 | C | T | NM_173175 | p.S786S | synonymous SNV | Schizophrenia | DNM:McCarthy_2014 | ||
PTK2B | chr8 | 27288396 | A | G | NM_004103 NM_004103 NM_173174 NM_173174 NM_173175 NM_173175 NM_173176 NM_173176 | . p.225K>E . p.225K>E . p.225K>E . p.225K>E | splice missense splice missense splice missense splice missense | Schizophrenia | DNM:Fromer_2014 |
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg18234130 | 8 | 27182889 | PTK2B | 5.772E-4 | 0.628 | 0.049 | DMG:Wockner_2014 |
cg23725592 | 8 | 27169067 | PTK2B | 1.14E-9 | -0.015 | 1.25E-6 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
NID2 | 0.84 | 0.77 |
NID1 | 0.81 | 0.68 |
LAMC1 | 0.78 | 0.71 |
COL6A3 | 0.77 | 0.43 |
FN1 | 0.77 | 0.69 |
LAMB1 | 0.77 | 0.73 |
COL1A2 | 0.76 | 0.52 |
COL4A1 | 0.76 | 0.60 |
SLC26A2 | 0.75 | 0.64 |
LOXL2 | 0.75 | 0.65 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.31 | -0.49 | -0.56 |
AF347015.21 | -0.48 | -0.59 |
MT-CO2 | -0.48 | -0.55 |
AF347015.27 | -0.46 | -0.50 |
FXYD1 | -0.45 | -0.47 |
IFI27 | -0.45 | -0.46 |
ENHO | -0.45 | -0.55 |
AF347015.8 | -0.45 | -0.51 |
AF347015.33 | -0.45 | -0.47 |
HIGD1B | -0.45 | -0.50 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0004871 | signal transducer activity | NAS | 10867021 | |
GO:0005515 | protein binding | IPI | 9020138 | |
GO:0005524 | ATP binding | IEA | - | |
GO:0004715 | non-membrane spanning protein tyrosine kinase activity | TAS | 8497321 | |
GO:0016740 | transferase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007172 | signal complex assembly | TAS | 7529876 | |
GO:0006461 | protein complex assembly | TAS | 10867021 | |
GO:0006468 | protein amino acid phosphorylation | TAS | 7529876 | |
GO:0006950 | response to stress | TAS | 8939945 | |
GO:0007165 | signal transduction | TAS | 7499242 |10867021 | |
GO:0008284 | positive regulation of cell proliferation | TAS | 10867021 | |
GO:0006915 | apoptosis | TAS | 10880513 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005856 | cytoskeleton | IEA | - | |
GO:0005737 | cytoplasm | TAS | 7499242 | |
GO:0005925 | focal adhesion | IEA | - | |
GO:0005886 | plasma membrane | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
ASAP2 | AMAP2 | CENTB3 | DDEF2 | FLJ42910 | KIAA0400 | PAG3 | PAP | Pap-alpha | SHAG1 | ArfGAP with SH3 domain, ankyrin repeat and PH domain 2 | - | HPRD,BioGRID | 10022920 |
BCAR1 | CAS | CAS1 | CASS1 | CRKAS | P130Cas | breast cancer anti-estrogen resistance 1 | - | HPRD,BioGRID | 8995252 |
CBL | C-CBL | CBL2 | RNF55 | Cas-Br-M (murine) ecotropic retroviral transforming sequence | - | HPRD,BioGRID | 11149930 |
CCR5 | CC-CKR-5 | CCCKR5 | CD195 | CKR-5 | CKR5 | CMKBR5 | chemokine (C-C motif) receptor 5 | - | HPRD | 9446638 |
CD2AP | CMS | DKFZp586H0519 | CD2-associated protein | Affinity Capture-Western | BioGRID | 15128873 |
CRK | CRKII | v-crk sarcoma virus CT10 oncogene homolog (avian) | - | HPRD | 10329689 |
DCC | CRC18 | CRCR1 | deleted in colorectal carcinoma | Affinity Capture-Western | BioGRID | 15494733 |
DLG3 | KIAA1232 | MRX | MRX90 | NE-Dlg | NEDLG | SAP102 | discs, large homolog 3 (neuroendocrine-dlg, Drosophila) | - | HPRD,BioGRID | 12576483 |
DLG4 | FLJ97752 | FLJ98574 | PSD95 | SAP90 | discs, large homolog 4 (Drosophila) | - | HPRD,BioGRID | 12576483 |
EFS | CAS3 | CASS3 | EFS1 | EFS2 | HEFS | SIN | embryonal Fyn-associated substrate | - | HPRD | 9750131 |
EGFR | ERBB | ERBB1 | HER1 | PIG61 | mENA | epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) | - | HPRD,BioGRID | 10777553 |
ERBB2 | CD340 | HER-2 | HER-2/neu | HER2 | NEU | NGL | TKR1 | v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian) | - | HPRD,BioGRID | 10713673 |
EWSR1 | EWS | Ewing sarcoma breakpoint region 1 | - | HPRD,BioGRID | 10322114 |
FYN | MGC45350 | SLK | SYN | FYN oncogene related to SRC, FGR, YES | - | HPRD,BioGRID | 9091579 |9104812 |10867021 |
GIT1 | - | G protein-coupled receptor kinase interacting ArfGAP 1 | Affinity Capture-Western | BioGRID | 12629171 |
GNA13 | G13 | MGC46138 | guanine nucleotide binding protein (G protein), alpha 13 | - | HPRD,BioGRID | 10821841 |
GRB2 | ASH | EGFRBP-GRB2 | Grb3-3 | MST084 | MSTP084 | growth factor receptor-bound protein 2 | - | HPRD,BioGRID | 10329689 |10354709 |
GRIN2A | NMDAR2A | NR2A | glutamate receptor, ionotropic, N-methyl D-aspartate 2A | - | HPRD,BioGRID | 11478920 |
GSN | DKFZp313L0718 | gelsolin (amyloidosis, Finnish type) | - | HPRD,BioGRID | 12578912 |
IL7R | CD127 | CDW127 | IL-7R-alpha | IL7RA | ILRA | interleukin 7 receptor | Affinity Capture-Western | BioGRID | 10702271 |
ITGB2 | CD18 | LAD | LCAMB | LFA-1 | MAC-1 | MF17 | MFI7 | integrin, beta 2 (complement component 3 receptor 3 and 4 subunit) | - | HPRD,BioGRID | 10961871 |
ITGB3 | CD61 | GP3A | GPIIIa | integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) | - | HPRD,BioGRID | 11683411 |
JAK1 | JAK1A | JAK1B | JTK3 | Janus kinase 1 (a protein tyrosine kinase) | - | HPRD,BioGRID | 10702271 |
JAK2 | JTK10 | Janus kinase 2 (a protein tyrosine kinase) | - | HPRD,BioGRID | 11818507 |
JAK3 | JAK-3 | JAK3_HUMAN | JAKL | L-JAK | LJAK | Janus kinase 3 (a protein tyrosine kinase, leukocyte) | - | HPRD,BioGRID | 9512511 |
KCNA2 | HBK5 | HK4 | HUKIV | KV1.2 | MGC50217 | MK2 | NGK1 | RBK2 | potassium voltage-gated channel, shaker-related subfamily, member 2 | - | HPRD,BioGRID | 11739373 |
LCK | YT16 | p56lck | pp58lck | lymphocyte-specific protein tyrosine kinase | - | HPRD,BioGRID | 9091579 |
LPXN | LDPL | leupaxin | - | HPRD,BioGRID | 9565592 |
LYN | FLJ26625 | JTK8 | v-yes-1 Yamaguchi sarcoma viral related oncogene homolog | - | HPRD,BioGRID | 11311138 |
MATK | CHK | CTK | DKFZp434N1212 | HHYLTK | HYL | HYLTK | Lsk | MGC1708 | MGC2101 | megakaryocyte-associated tyrosine kinase | - | HPRD | 12063569 |
MCAM | CD146 | MUC18 | melanoma cell adhesion molecule | - | HPRD | 11036077 |
NEDD9 | CAS-L | CAS2 | CASL | CASS2 | HEF1 | dJ49G10.2 | dJ761I2.1 | neural precursor cell expressed, developmentally down-regulated 9 | - | HPRD,BioGRID | 9020138 |
NPHP1 | FLJ97602 | JBTS4 | NPH1 | SLSN1 | nephronophthisis 1 (juvenile) | - | HPRD,BioGRID | 11493697 |
PIK3R1 | GRB1 | p85 | p85-ALPHA | phosphoinositide-3-kinase, regulatory subunit 1 (alpha) | - | HPRD | 10797305 |
PITPNM1 | DRES9 | FLJ44997 | NIR2 | PITPNM | RDGB | RDGB1 | RDGBA | RDGBA1 | Rd9 | phosphatidylinositol transfer protein, membrane-associated 1 | - | HPRD,BioGRID | 10022914 |
PITPNM2 | KIAA1457 | NIR3 | RDGB2 | RDGBA2 | phosphatidylinositol transfer protein, membrane-associated 2 | - | HPRD,BioGRID | 10022914 |
PITPNM3 | CORD5 | MGC157740 | MGC157741 | NIR1 | RDGBA3 | PITPNM family member 3 | - | HPRD,BioGRID | 10022914 |
PRKCD | MAY1 | MGC49908 | PKCD | nPKC-delta | protein kinase C, delta | - | HPRD,BioGRID | 11352632 |
PTK2B | CADTK | CAKB | FADK2 | FAK2 | FRNK | PKB | PTK | PYK2 | RAFTK | PTK2B protein tyrosine kinase 2 beta | Biochemical Activity | BioGRID | 9512511 |
PTPN11 | BPTP3 | CFC | MGC14433 | NS1 | PTP-1D | PTP2C | SH-PTP2 | SH-PTP3 | SHP2 | protein tyrosine phosphatase, non-receptor type 11 | - | HPRD,BioGRID | 10880513 |
PTPN12 | PTP-PEST | PTPG1 | protein tyrosine phosphatase, non-receptor type 12 | - | HPRD,BioGRID | 11337490 |
PTPN6 | HCP | HCPH | HPTP1C | PTP-1C | SH-PTP1 | SHP-1 | SHP-1L | SHP1 | protein tyrosine phosphatase, non-receptor type 6 | - | HPRD,BioGRID | 10521452 |10747947 |
PXN | FLJ16691 | paxillin | - | HPRD,BioGRID | 9099734 |
RASA1 | CM-AVM | CMAVM | DKFZp434N071 | GAP | PKWS | RASA | RASGAP | p120GAP | p120RASGAP | RAS p21 protein activator (GTPase activating protein) 1 | - | HPRD,BioGRID | 8798684 |10708762 |10713673 |
RB1CC1 | CC1 | DRAGOU14 | FIP200 | RB1-inducible coiled-coil 1 | Affinity Capture-Western Phenotypic Suppression Reconstituted Complex Two-hybrid | BioGRID | 10769033 |
SHC1 | FLJ26504 | SHC | SHCA | SHC (Src homology 2 domain containing) transforming protein 1 | - | HPRD | 7544443 |
SLC2A1 | DYT17 | DYT18 | GLUT | GLUT1 | MGC141895 | MGC141896 | PED | solute carrier family 2 (facilitated glucose transporter), member 1 | - | HPRD,BioGRID | 11007796 |
SORBS1 | CAP | DKFZp451C066 | DKFZp586P1422 | FLAF2 | FLJ12406 | KIAA1296 | R85FL | SH3D5 | SH3P12 | SORB1 | sorbin and SH3 domain containing 1 | Affinity Capture-Western | BioGRID | 15128873 |
SORBS2 | ARGBP2 | FLJ93447 | KIAA0777 | PRO0618 | sorbin and SH3 domain containing 2 | ArgBP2 interacts with Pyk2. | BIND | 15128873 |
SORBS2 | ARGBP2 | FLJ93447 | KIAA0777 | PRO0618 | sorbin and SH3 domain containing 2 | - | HPRD,BioGRID | 15128873 |
SRC | ASV | SRC1 | c-SRC | p60-Src | v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) | - | HPRD | 8849729 |10777553 |
SRC | ASV | SRC1 | c-SRC | p60-Src | v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) | Affinity Capture-Western Reconstituted Complex | BioGRID | 8849729 |10521452 |10777553 |
SYK | DKFZp313N1010 | FLJ25043 | FLJ37489 | spleen tyrosine kinase | - | HPRD,BioGRID | 10747947 |
TGFB1I1 | ARA55 | HIC-5 | HIC5 | TSC-5 | transforming growth factor beta 1 induced transcript 1 | - | HPRD | 9422762 |11856738 |
TGFB1I1 | ARA55 | HIC-5 | HIC5 | TSC-5 | transforming growth factor beta 1 induced transcript 1 | Affinity Capture-Western Reconstituted Complex Two-hybrid | BioGRID | 9422762 |9858471 |11856738 |
TLN1 | ILWEQ | KIAA1027 | TLN | talin 1 | - | HPRD,BioGRID | 9442086 |
VAV1 | VAV | vav 1 guanine nucleotide exchange factor | - | HPRD,BioGRID | 10867021 |
ZAP70 | FLJ17670 | FLJ17679 | SRK | STD | TZK | ZAP-70 | zeta-chain (TCR) associated protein kinase 70kDa | - | HPRD | 10867021 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG CALCIUM SIGNALING PATHWAY | 178 | 134 | All SZGR 2.0 genes in this pathway |
KEGG CHEMOKINE SIGNALING PATHWAY | 190 | 128 | All SZGR 2.0 genes in this pathway |
KEGG NATURAL KILLER CELL MEDIATED CYTOTOXICITY | 137 | 92 | All SZGR 2.0 genes in this pathway |
KEGG LEUKOCYTE TRANSENDOTHELIAL MIGRATION | 118 | 78 | All SZGR 2.0 genes in this pathway |
KEGG GNRH SIGNALING PATHWAY | 101 | 77 | All SZGR 2.0 genes in this pathway |
BIOCARTA AT1R PATHWAY | 36 | 28 | All SZGR 2.0 genes in this pathway |
BIOCARTA BIOPEPTIDES PATHWAY | 45 | 35 | All SZGR 2.0 genes in this pathway |
BIOCARTA CXCR4 PATHWAY | 24 | 22 | All SZGR 2.0 genes in this pathway |
BIOCARTA IL7 PATHWAY | 17 | 14 | All SZGR 2.0 genes in this pathway |
BIOCARTA PYK2 PATHWAY | 31 | 24 | All SZGR 2.0 genes in this pathway |
BIOCARTA CCR5 PATHWAY | 20 | 16 | All SZGR 2.0 genes in this pathway |
BIOCARTA NKCELLS PATHWAY | 20 | 13 | All SZGR 2.0 genes in this pathway |
BIOCARTA ACH PATHWAY | 16 | 13 | All SZGR 2.0 genes in this pathway |
BIOCARTA MET PATHWAY | 37 | 30 | All SZGR 2.0 genes in this pathway |
BIOCARTA PAR1 PATHWAY | 37 | 28 | All SZGR 2.0 genes in this pathway |
SA PTEN PATHWAY | 17 | 14 | All SZGR 2.0 genes in this pathway |
PID ENDOTHELIN PATHWAY | 63 | 52 | All SZGR 2.0 genes in this pathway |
PID LYSOPHOSPHOLIPID PATHWAY | 66 | 53 | All SZGR 2.0 genes in this pathway |
PID AR PATHWAY | 61 | 46 | All SZGR 2.0 genes in this pathway |
PID AVB3 OPN PATHWAY | 31 | 29 | All SZGR 2.0 genes in this pathway |
PID IL2 1PATHWAY | 55 | 43 | All SZGR 2.0 genes in this pathway |
PID CXCR4 PATHWAY | 102 | 78 | All SZGR 2.0 genes in this pathway |
PID AVB3 INTEGRIN PATHWAY | 75 | 53 | All SZGR 2.0 genes in this pathway |
PID VEGFR1 2 PATHWAY | 69 | 57 | All SZGR 2.0 genes in this pathway |
PID ALPHA SYNUCLEIN PATHWAY | 33 | 25 | All SZGR 2.0 genes in this pathway |
PID FGF PATHWAY | 55 | 37 | All SZGR 2.0 genes in this pathway |
PID INTEGRIN A4B1 PATHWAY | 33 | 24 | All SZGR 2.0 genes in this pathway |
REACTOME CELL CELL COMMUNICATION | 120 | 77 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY ILS | 107 | 86 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNAL REGULATORY PROTEIN SIRP FAMILY INTERACTIONS | 12 | 10 | All SZGR 2.0 genes in this pathway |
REACTOME IL 2 SIGNALING | 41 | 34 | All SZGR 2.0 genes in this pathway |
REACTOME IMMUNE SYSTEM | 933 | 616 | All SZGR 2.0 genes in this pathway |
REACTOME CYTOKINE SIGNALING IN IMMUNE SYSTEM | 270 | 204 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 1 UP | 380 | 236 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 2 UP | 418 | 263 | All SZGR 2.0 genes in this pathway |
BIDUS METASTASIS DN | 161 | 93 | All SZGR 2.0 genes in this pathway |
MCBRYAN PUBERTAL BREAST 6 7WK UP | 197 | 135 | All SZGR 2.0 genes in this pathway |
MCBRYAN PUBERTAL TGFB1 TARGETS UP | 169 | 127 | All SZGR 2.0 genes in this pathway |
SCHLOSSER SERUM RESPONSE UP | 134 | 93 | All SZGR 2.0 genes in this pathway |
DIRMEIER LMP1 RESPONSE EARLY | 66 | 48 | All SZGR 2.0 genes in this pathway |
RICKMAN METASTASIS DN | 261 | 155 | All SZGR 2.0 genes in this pathway |
STARK PREFRONTAL CORTEX 22Q11 DELETION UP | 195 | 138 | All SZGR 2.0 genes in this pathway |
MORI PRE BI LYMPHOCYTE DN | 77 | 49 | All SZGR 2.0 genes in this pathway |
ASTON MAJOR DEPRESSIVE DISORDER DN | 160 | 110 | All SZGR 2.0 genes in this pathway |
PENG RAPAMYCIN RESPONSE UP | 203 | 130 | All SZGR 2.0 genes in this pathway |
HALMOS CEBPA TARGETS UP | 52 | 34 | All SZGR 2.0 genes in this pathway |
LENAOUR DENDRITIC CELL MATURATION DN | 128 | 90 | All SZGR 2.0 genes in this pathway |
XU RESPONSE TO TRETINOIN UP | 16 | 10 | All SZGR 2.0 genes in this pathway |
BASSO CD40 SIGNALING UP | 101 | 76 | All SZGR 2.0 genes in this pathway |
MODY HIPPOCAMPUS POSTNATAL | 63 | 50 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP | 953 | 554 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP | 783 | 442 | All SZGR 2.0 genes in this pathway |
ZHENG BOUND BY FOXP3 | 491 | 310 | All SZGR 2.0 genes in this pathway |
ZHENG FOXP3 TARGETS IN T LYMPHOCYTE DN | 37 | 29 | All SZGR 2.0 genes in this pathway |
GAZIN EPIGENETIC SILENCING BY KRAS | 26 | 16 | All SZGR 2.0 genes in this pathway |
AMUNDSON POOR SURVIVAL AFTER GAMMA RADIATION 2G | 171 | 96 | All SZGR 2.0 genes in this pathway |
RAY TUMORIGENESIS BY ERBB2 CDC25A UP | 104 | 57 | All SZGR 2.0 genes in this pathway |
FIRESTEIN CTNNB1 PATHWAY | 33 | 23 | All SZGR 2.0 genes in this pathway |
CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 8 | 49 | 36 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 30MIN UP | 56 | 38 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS UP | 745 | 475 | All SZGR 2.0 genes in this pathway |
PLASARI TGFB1 TARGETS 10HR UP | 199 | 143 | All SZGR 2.0 genes in this pathway |
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF | 516 | 308 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-19 | 124 | 130 | m8 | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
miR-23 | 515 | 521 | m8 | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
miR-323 | 514 | 521 | 1A,m8 | hsa-miR-323brain | GCACAUUACACGGUCGACCUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.