SZGR2

Summary ?

GeneID	2185
Symbol	PTK2B
Synonyms	CADTK\|CAKB\|FADK2\|FAK2\|PKB\|PTK\|PYK2\|RAFTK
Description	protein tyrosine kinase 2 beta
Reference	MIM:601212\|HGNC:HGNC:9612\|Ensembl:ENSG00000120899\|HPRD:03131\|Vega:OTTHUMG00000102082
Gene type	protein-coding
Map location	8p21.1
Pascal p-value	0.003
Sherlock p-value	0.278
TADA p-value	0.018
Fetal beta	-1.84
DMG	2 (# studies)
Support	G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.humanNRC G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets Potential synaptic genes

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	2
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	2
DNM:Fromer_2014	Whole Exome Sequencing analysis	This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA.
DNM:McCarthy_2014	Whole Exome Sequencing analysis	Whole exome sequencing of 57 trios with sporadic or familial schizophrenia.
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_I	Genome scan meta-analysis	Psr: 0.031
GSMA_IIE	Genome scan meta-analysis (European-ancestry samples)	Psr: 0.00057
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.03086
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.5281

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
PTK2B	chr8	27308409	C	T	NM_173175	p.S786S	synonymous SNV			Schizophrenia	DNM:McCarthy_2014
PTK2B	chr8	27288396	A	G	NM_004103 NM_004103 NM_173174 NM_173174 NM_173175 NM_173175 NM_173176 NM_173176	. p.225K>E . p.225K>E . p.225K>E . p.225K>E	splice missense splice missense splice missense splice missense			Schizophrenia	DNM:Fromer_2014

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg18234130	8	27182889	PTK2B	5.772E-4	0.628	0.049	DMG:Wockner_2014
cg23725592	8	27169067	PTK2B	1.14E-9	-0.015	1.25E-6	DMG:Jaffe_2016

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
NID2	0.84	0.77
NID1	0.81	0.68
LAMC1	0.78	0.71
COL6A3	0.77	0.43
FN1	0.77	0.69
LAMB1	0.77	0.73
COL1A2	0.76	0.52
COL4A1	0.76	0.60
SLC26A2	0.75	0.64
LOXL2	0.75	0.65

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.31	-0.49	-0.56
AF347015.21	-0.48	-0.59
MT-CO2	-0.48	-0.55
AF347015.27	-0.46	-0.50
FXYD1	-0.45	-0.47
IFI27	-0.45	-0.46
ENHO	-0.45	-0.55
AF347015.8	-0.45	-0.51
AF347015.33	-0.45	-0.47
HIGD1B	-0.45	-0.50

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0004871	signal transducer activity	NAS		10867021
GO:0005515	protein binding	IPI		9020138
GO:0005524	ATP binding	IEA		-
GO:0004715	non-membrane spanning protein tyrosine kinase activity	TAS		8497321
GO:0016740	transferase activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007172	signal complex assembly	TAS		7529876
GO:0006461	protein complex assembly	TAS		10867021
GO:0006468	protein amino acid phosphorylation	TAS		7529876
GO:0006950	response to stress	TAS		8939945
GO:0007165	signal transduction	TAS		7499242 \|10867021
GO:0008284	positive regulation of cell proliferation	TAS		10867021
GO:0006915	apoptosis	TAS		10880513
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005856	cytoskeleton	IEA		-
GO:0005737	cytoplasm	TAS		7499242
GO:0005925	focal adhesion	IEA		-
GO:0005886	plasma membrane	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ASAP2	AMAP2 \| CENTB3 \| DDEF2 \| FLJ42910 \| KIAA0400 \| PAG3 \| PAP \| Pap-alpha \| SHAG1	ArfGAP with SH3 domain, ankyrin repeat and PH domain 2	-	HPRD,BioGRID	10022920
BCAR1	CAS \| CAS1 \| CASS1 \| CRKAS \| P130Cas	breast cancer anti-estrogen resistance 1	-	HPRD,BioGRID	8995252
CBL	C-CBL \| CBL2 \| RNF55	Cas-Br-M (murine) ecotropic retroviral transforming sequence	-	HPRD,BioGRID	11149930
CCR5	CC-CKR-5 \| CCCKR5 \| CD195 \| CKR-5 \| CKR5 \| CMKBR5	chemokine (C-C motif) receptor 5	-	HPRD	9446638
CD2AP	CMS \| DKFZp586H0519	CD2-associated protein	Affinity Capture-Western	BioGRID	15128873
CRK	CRKII	v-crk sarcoma virus CT10 oncogene homolog (avian)	-	HPRD	10329689
DCC	CRC18 \| CRCR1	deleted in colorectal carcinoma	Affinity Capture-Western	BioGRID	15494733
DLG3	KIAA1232 \| MRX \| MRX90 \| NE-Dlg \| NEDLG \| SAP102	discs, large homolog 3 (neuroendocrine-dlg, Drosophila)	-	HPRD,BioGRID	12576483
DLG4	FLJ97752 \| FLJ98574 \| PSD95 \| SAP90	discs, large homolog 4 (Drosophila)	-	HPRD,BioGRID	12576483
EFS	CAS3 \| CASS3 \| EFS1 \| EFS2 \| HEFS \| SIN	embryonal Fyn-associated substrate	-	HPRD	9750131
EGFR	ERBB \| ERBB1 \| HER1 \| PIG61 \| mENA	epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)	-	HPRD,BioGRID	10777553
ERBB2	CD340 \| HER-2 \| HER-2/neu \| HER2 \| NEU \| NGL \| TKR1	v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)	-	HPRD,BioGRID	10713673
EWSR1	EWS	Ewing sarcoma breakpoint region 1	-	HPRD,BioGRID	10322114
FYN	MGC45350 \| SLK \| SYN	FYN oncogene related to SRC, FGR, YES	-	HPRD,BioGRID	9091579 \|9104812 \|10867021
GIT1	-	G protein-coupled receptor kinase interacting ArfGAP 1	Affinity Capture-Western	BioGRID	12629171
GNA13	G13 \| MGC46138	guanine nucleotide binding protein (G protein), alpha 13	-	HPRD,BioGRID	10821841
GRB2	ASH \| EGFRBP-GRB2 \| Grb3-3 \| MST084 \| MSTP084	growth factor receptor-bound protein 2	-	HPRD,BioGRID	10329689 \|10354709
GRIN2A	NMDAR2A \| NR2A	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	-	HPRD,BioGRID	11478920
GSN	DKFZp313L0718	gelsolin (amyloidosis, Finnish type)	-	HPRD,BioGRID	12578912
IL7R	CD127 \| CDW127 \| IL-7R-alpha \| IL7RA \| ILRA	interleukin 7 receptor	Affinity Capture-Western	BioGRID	10702271
ITGB2	CD18 \| LAD \| LCAMB \| LFA-1 \| MAC-1 \| MF17 \| MFI7	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	-	HPRD,BioGRID	10961871
ITGB3	CD61 \| GP3A \| GPIIIa	integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)	-	HPRD,BioGRID	11683411
JAK1	JAK1A \| JAK1B \| JTK3	Janus kinase 1 (a protein tyrosine kinase)	-	HPRD,BioGRID	10702271
JAK2	JTK10	Janus kinase 2 (a protein tyrosine kinase)	-	HPRD,BioGRID	11818507
JAK3	JAK-3 \| JAK3_HUMAN \| JAKL \| L-JAK \| LJAK	Janus kinase 3 (a protein tyrosine kinase, leukocyte)	-	HPRD,BioGRID	9512511
KCNA2	HBK5 \| HK4 \| HUKIV \| KV1.2 \| MGC50217 \| MK2 \| NGK1 \| RBK2	potassium voltage-gated channel, shaker-related subfamily, member 2	-	HPRD,BioGRID	11739373
LCK	YT16 \| p56lck \| pp58lck	lymphocyte-specific protein tyrosine kinase	-	HPRD,BioGRID	9091579
LPXN	LDPL	leupaxin	-	HPRD,BioGRID	9565592
LYN	FLJ26625 \| JTK8	v-yes-1 Yamaguchi sarcoma viral related oncogene homolog	-	HPRD,BioGRID	11311138
MATK	CHK \| CTK \| DKFZp434N1212 \| HHYLTK \| HYL \| HYLTK \| Lsk \| MGC1708 \| MGC2101	megakaryocyte-associated tyrosine kinase	-	HPRD	12063569
MCAM	CD146 \| MUC18	melanoma cell adhesion molecule	-	HPRD	11036077
NEDD9	CAS-L \| CAS2 \| CASL \| CASS2 \| HEF1 \| dJ49G10.2 \| dJ761I2.1	neural precursor cell expressed, developmentally down-regulated 9	-	HPRD,BioGRID	9020138
NPHP1	FLJ97602 \| JBTS4 \| NPH1 \| SLSN1	nephronophthisis 1 (juvenile)	-	HPRD,BioGRID	11493697
PIK3R1	GRB1 \| p85 \| p85-ALPHA	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	-	HPRD	10797305
PITPNM1	DRES9 \| FLJ44997 \| NIR2 \| PITPNM \| RDGB \| RDGB1 \| RDGBA \| RDGBA1 \| Rd9	phosphatidylinositol transfer protein, membrane-associated 1	-	HPRD,BioGRID	10022914
PITPNM2	KIAA1457 \| NIR3 \| RDGB2 \| RDGBA2	phosphatidylinositol transfer protein, membrane-associated 2	-	HPRD,BioGRID	10022914
PITPNM3	CORD5 \| MGC157740 \| MGC157741 \| NIR1 \| RDGBA3	PITPNM family member 3	-	HPRD,BioGRID	10022914
PRKCD	MAY1 \| MGC49908 \| PKCD \| nPKC-delta	protein kinase C, delta	-	HPRD,BioGRID	11352632
PTK2B	CADTK \| CAKB \| FADK2 \| FAK2 \| FRNK \| PKB \| PTK \| PYK2 \| RAFTK	PTK2B protein tyrosine kinase 2 beta	Biochemical Activity	BioGRID	9512511
PTPN11	BPTP3 \| CFC \| MGC14433 \| NS1 \| PTP-1D \| PTP2C \| SH-PTP2 \| SH-PTP3 \| SHP2	protein tyrosine phosphatase, non-receptor type 11	-	HPRD,BioGRID	10880513
PTPN12	PTP-PEST \| PTPG1	protein tyrosine phosphatase, non-receptor type 12	-	HPRD,BioGRID	11337490
PTPN6	HCP \| HCPH \| HPTP1C \| PTP-1C \| SH-PTP1 \| SHP-1 \| SHP-1L \| SHP1	protein tyrosine phosphatase, non-receptor type 6	-	HPRD,BioGRID	10521452 \|10747947
PXN	FLJ16691	paxillin	-	HPRD,BioGRID	9099734
RASA1	CM-AVM \| CMAVM \| DKFZp434N071 \| GAP \| PKWS \| RASA \| RASGAP \| p120GAP \| p120RASGAP	RAS p21 protein activator (GTPase activating protein) 1	-	HPRD,BioGRID	8798684 \|10708762 \|10713673
RB1CC1	CC1 \| DRAGOU14 \| FIP200	RB1-inducible coiled-coil 1	Affinity Capture-Western Phenotypic Suppression Reconstituted Complex Two-hybrid	BioGRID	10769033
SHC1	FLJ26504 \| SHC \| SHCA	SHC (Src homology 2 domain containing) transforming protein 1	-	HPRD	7544443
SLC2A1	DYT17 \| DYT18 \| GLUT \| GLUT1 \| MGC141895 \| MGC141896 \| PED	solute carrier family 2 (facilitated glucose transporter), member 1	-	HPRD,BioGRID	11007796
SORBS1	CAP \| DKFZp451C066 \| DKFZp586P1422 \| FLAF2 \| FLJ12406 \| KIAA1296 \| R85FL \| SH3D5 \| SH3P12 \| SORB1	sorbin and SH3 domain containing 1	Affinity Capture-Western	BioGRID	15128873
SORBS2	ARGBP2 \| FLJ93447 \| KIAA0777 \| PRO0618	sorbin and SH3 domain containing 2	ArgBP2 interacts with Pyk2.	BIND	15128873
SORBS2	ARGBP2 \| FLJ93447 \| KIAA0777 \| PRO0618	sorbin and SH3 domain containing 2	-	HPRD,BioGRID	15128873
SRC	ASV \| SRC1 \| c-SRC \| p60-Src	v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)	-	HPRD	8849729 \|10777553
SRC	ASV \| SRC1 \| c-SRC \| p60-Src	v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)	Affinity Capture-Western Reconstituted Complex	BioGRID	8849729 \|10521452 \|10777553
SYK	DKFZp313N1010 \| FLJ25043 \| FLJ37489	spleen tyrosine kinase	-	HPRD,BioGRID	10747947
TGFB1I1	ARA55 \| HIC-5 \| HIC5 \| TSC-5	transforming growth factor beta 1 induced transcript 1	-	HPRD	9422762 \|11856738
TGFB1I1	ARA55 \| HIC-5 \| HIC5 \| TSC-5	transforming growth factor beta 1 induced transcript 1	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	9422762 \|9858471 \|11856738
TLN1	ILWEQ \| KIAA1027 \| TLN	talin 1	-	HPRD,BioGRID	9442086
VAV1	VAV	vav 1 guanine nucleotide exchange factor	-	HPRD,BioGRID	10867021
ZAP70	FLJ17670 \| FLJ17679 \| SRK \| STD \| TZK \| ZAP-70	zeta-chain (TCR) associated protein kinase 70kDa	-	HPRD	10867021

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG CALCIUM SIGNALING PATHWAY	178	134	All SZGR 2.0 genes in this pathway
KEGG CHEMOKINE SIGNALING PATHWAY	190	128	All SZGR 2.0 genes in this pathway
KEGG NATURAL KILLER CELL MEDIATED CYTOTOXICITY	137	92	All SZGR 2.0 genes in this pathway
KEGG LEUKOCYTE TRANSENDOTHELIAL MIGRATION	118	78	All SZGR 2.0 genes in this pathway
KEGG GNRH SIGNALING PATHWAY	101	77	All SZGR 2.0 genes in this pathway
BIOCARTA AT1R PATHWAY	36	28	All SZGR 2.0 genes in this pathway
BIOCARTA BIOPEPTIDES PATHWAY	45	35	All SZGR 2.0 genes in this pathway
BIOCARTA CXCR4 PATHWAY	24	22	All SZGR 2.0 genes in this pathway
BIOCARTA IL7 PATHWAY	17	14	All SZGR 2.0 genes in this pathway
BIOCARTA PYK2 PATHWAY	31	24	All SZGR 2.0 genes in this pathway
BIOCARTA CCR5 PATHWAY	20	16	All SZGR 2.0 genes in this pathway
BIOCARTA NKCELLS PATHWAY	20	13	All SZGR 2.0 genes in this pathway
BIOCARTA ACH PATHWAY	16	13	All SZGR 2.0 genes in this pathway
BIOCARTA MET PATHWAY	37	30	All SZGR 2.0 genes in this pathway
BIOCARTA PAR1 PATHWAY	37	28	All SZGR 2.0 genes in this pathway
SA PTEN PATHWAY	17	14	All SZGR 2.0 genes in this pathway
PID ENDOTHELIN PATHWAY	63	52	All SZGR 2.0 genes in this pathway
PID LYSOPHOSPHOLIPID PATHWAY	66	53	All SZGR 2.0 genes in this pathway
PID AR PATHWAY	61	46	All SZGR 2.0 genes in this pathway
PID AVB3 OPN PATHWAY	31	29	All SZGR 2.0 genes in this pathway
PID IL2 1PATHWAY	55	43	All SZGR 2.0 genes in this pathway
PID CXCR4 PATHWAY	102	78	All SZGR 2.0 genes in this pathway
PID AVB3 INTEGRIN PATHWAY	75	53	All SZGR 2.0 genes in this pathway
PID VEGFR1 2 PATHWAY	69	57	All SZGR 2.0 genes in this pathway
PID ALPHA SYNUCLEIN PATHWAY	33	25	All SZGR 2.0 genes in this pathway
PID FGF PATHWAY	55	37	All SZGR 2.0 genes in this pathway
PID INTEGRIN A4B1 PATHWAY	33	24	All SZGR 2.0 genes in this pathway
REACTOME CELL CELL COMMUNICATION	120	77	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY ILS	107	86	All SZGR 2.0 genes in this pathway
REACTOME SIGNAL REGULATORY PROTEIN SIRP FAMILY INTERACTIONS	12	10	All SZGR 2.0 genes in this pathway
REACTOME IL 2 SIGNALING	41	34	All SZGR 2.0 genes in this pathway
REACTOME IMMUNE SYSTEM	933	616	All SZGR 2.0 genes in this pathway
REACTOME CYTOKINE SIGNALING IN IMMUNE SYSTEM	270	204	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 1 UP	380	236	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 2 UP	418	263	All SZGR 2.0 genes in this pathway
BIDUS METASTASIS DN	161	93	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 6 7WK UP	197	135	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL TGFB1 TARGETS UP	169	127	All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE UP	134	93	All SZGR 2.0 genes in this pathway
DIRMEIER LMP1 RESPONSE EARLY	66	48	All SZGR 2.0 genes in this pathway
RICKMAN METASTASIS DN	261	155	All SZGR 2.0 genes in this pathway
STARK PREFRONTAL CORTEX 22Q11 DELETION UP	195	138	All SZGR 2.0 genes in this pathway
MORI PRE BI LYMPHOCYTE DN	77	49	All SZGR 2.0 genes in this pathway
ASTON MAJOR DEPRESSIVE DISORDER DN	160	110	All SZGR 2.0 genes in this pathway
PENG RAPAMYCIN RESPONSE UP	203	130	All SZGR 2.0 genes in this pathway
HALMOS CEBPA TARGETS UP	52	34	All SZGR 2.0 genes in this pathway
LENAOUR DENDRITIC CELL MATURATION DN	128	90	All SZGR 2.0 genes in this pathway
XU RESPONSE TO TRETINOIN UP	16	10	All SZGR 2.0 genes in this pathway
BASSO CD40 SIGNALING UP	101	76	All SZGR 2.0 genes in this pathway
MODY HIPPOCAMPUS POSTNATAL	63	50	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP	953	554	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP	783	442	All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3	491	310	All SZGR 2.0 genes in this pathway
ZHENG FOXP3 TARGETS IN T LYMPHOCYTE DN	37	29	All SZGR 2.0 genes in this pathway
GAZIN EPIGENETIC SILENCING BY KRAS	26	16	All SZGR 2.0 genes in this pathway
AMUNDSON POOR SURVIVAL AFTER GAMMA RADIATION 2G	171	96	All SZGR 2.0 genes in this pathway
RAY TUMORIGENESIS BY ERBB2 CDC25A UP	104	57	All SZGR 2.0 genes in this pathway
FIRESTEIN CTNNB1 PATHWAY	33	23	All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK	1210	725	All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 8	49	36	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 30MIN UP	56	38	All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS CALB1 CORR UP	548	370	All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS UP	745	475	All SZGR 2.0 genes in this pathway
PLASARI TGFB1 TARGETS 10HR UP	199	143	All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF	516	308	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-19	124	130	m8	hsa-miR-19a	UGUGCAAAUCUAUGCAAAACUGA
miR-19	124	130	m8	hsa-miR-19b	UGUGCAAAUCCAUGCAAAACUGA
miR-23	515	521	m8	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
miR-23	515	521	m8	hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-323	514	521	1A,m8	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: PTK2B