Gene Page: TBC1D9B
Summary ?
| GeneID | 23061 |
| Symbol | TBC1D9B |
| Synonyms | GRAMD9B |
| Description | TBC1 domain family member 9B |
| Reference | HGNC:HGNC:29097|Ensembl:ENSG00000197226|HPRD:10015|Vega:OTTHUMG00000130911 |
| Gene type | protein-coding |
| Map location | 5q35.3 |
| Pascal p-value | 0.111 |
| Fetal beta | -0.555 |
| DMG | 1 (# studies) |
| eGene | Caudate basal ganglia Cortex Frontal Cortex BA9 Hippocampus Nucleus accumbens basal ganglia Putamen basal ganglia |
| Support | CompositeSet Darnell FMRP targets Ascano FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.0276 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg01132502 | 5 | 179335607 | TBC1D9B | 1.92E-8 | 0.674 | 0.002 | DMG:Wockner_2014 |
| cg11484115 | 5 | 179335704 | TBC1D9B | 1.379E-4 | 0.395 | 0.031 | DMG:Wockner_2014 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs272441 | 5 | 179301260 | TBC1D9B | ENSG00000197226.8 | 8.27474E-7 | 0.01 | 33599 | gtex_brain_putamen_basal |
| rs192426 | 5 | 179304329 | TBC1D9B | ENSG00000197226.8 | 2.9655E-7 | 0.01 | 30530 | gtex_brain_putamen_basal |
| rs152234 | 5 | 179335060 | TBC1D9B | ENSG00000197226.8 | 1.83611E-7 | 0.01 | -201 | gtex_brain_putamen_basal |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| BRCA2 | 0.91 | 0.72 |
| RBL1 | 0.91 | 0.79 |
| C6orf167 | 0.90 | 0.81 |
| KNTC1 | 0.90 | 0.84 |
| CENPI | 0.89 | 0.73 |
| ATAD2 | 0.89 | 0.82 |
| MCM8 | 0.88 | 0.75 |
| TIMELESS | 0.88 | 0.77 |
| NCAPD3 | 0.88 | 0.85 |
| C4orf21 | 0.88 | 0.78 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.31 | -0.51 | -0.74 |
| MT-CO2 | -0.51 | -0.75 |
| FXYD1 | -0.50 | -0.73 |
| AF347015.27 | -0.50 | -0.71 |
| AF347015.33 | -0.50 | -0.70 |
| IFI27 | -0.49 | -0.72 |
| AF347015.8 | -0.49 | -0.73 |
| C5orf53 | -0.48 | -0.60 |
| S100B | -0.48 | -0.67 |
| MT-CYB | -0.48 | -0.69 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005097 | Rab GTPase activator activity | IEA | - | |
| GO:0005096 | GTPase activator activity | IEA | - | |
| GO:0005509 | calcium ion binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0032313 | regulation of Rab GTPase activity | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005622 | intracellular | IEA | - | |
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| PARENT MTOR SIGNALING UP | 567 | 375 | All SZGR 2.0 genes in this pathway |
| LIU SOX4 TARGETS DN | 309 | 191 | All SZGR 2.0 genes in this pathway |
| GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN | 493 | 298 | All SZGR 2.0 genes in this pathway |
| PROVENZANI METASTASIS DN | 136 | 94 | All SZGR 2.0 genes in this pathway |
| STARK PREFRONTAL CORTEX 22Q11 DELETION DN | 517 | 309 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 48HR DN | 504 | 323 | All SZGR 2.0 genes in this pathway |
| DEBIASI APOPTOSIS BY REOVIRUS INFECTION DN | 287 | 208 | All SZGR 2.0 genes in this pathway |
| BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 | 720 | 440 | All SZGR 2.0 genes in this pathway |
| CHANDRAN METASTASIS DN | 306 | 191 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
| KRIEG HYPOXIA NOT VIA KDM3A | 770 | 480 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-124.1 | 680 | 687 | 1A,m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
| miR-124/506 | 680 | 686 | 1A | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
| hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
| miR-128 | 668 | 674 | m8 | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
| hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.