SZGR2

Summary ?

GeneID	23114
Symbol	NFASC
Synonyms	NF\|NRCAML
Description	neurofascin
Reference	MIM:609145\|HGNC:HGNC:29866\|Ensembl:ENSG00000163531\|HPRD:12372\|Vega:OTTHUMG00000151697
Gene type	protein-coding
Map location	1q32.1
TADA p-value	0.023
Fetal beta	-0.27
DMG	1 (# studies)
Support	CELL ADHESION AND TRANSSYNAPTIC SIGNALING G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS CompositeSet

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
DNM:Fromer_2014	Whole Exome Sequencing analysis	This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA.
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0024

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
NFASC	chr1	204942490	T	C	NM_001005388 NM_001005389 NM_001160331 NM_001160332 NM_001160333 NM_015090	p.408C>R p.408C>R p.419C>R p.419C>R p.402C>R p.419C>R	missense missense missense missense missense missense			Schizophrenia	DNM:Fromer_2014

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg24085946	1	204797839	NFASC	3.809E-4	-0.161	0.043	DMG:Wockner_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
GPR176	0.77	0.81
EVI5L	0.77	0.78
AC132186.2	0.77	0.81
GPR68	0.75	0.83
SYT3	0.75	0.81
CNRIP1	0.75	0.78
MYO16	0.75	0.74
GNAZ	0.74	0.73
SESN2	0.74	0.76
TRAF5	0.73	0.77

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.21	-0.50	-0.44
AF347015.2	-0.50	-0.43
MT-CO2	-0.50	-0.42
AF347015.31	-0.49	-0.42
AF347015.8	-0.48	-0.41
GNG11	-0.47	-0.51
AF347015.33	-0.47	-0.38
MT-CYB	-0.46	-0.38
AC098691.2	-0.46	-0.49
AP002478.3	-0.46	-0.47

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007155	cell adhesion	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0016021	integral to membrane	IEA		-
GO:0005886	plasma membrane	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG CELL ADHESION MOLECULES CAMS	134	93	All SZGR 2.0 genes in this pathway
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP	255	177	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS DN	536	332	All SZGR 2.0 genes in this pathway
LEE NEURAL CREST STEM CELL UP	146	99	All SZGR 2.0 genes in this pathway
FALVELLA SMOKERS WITH LUNG CANCER	80	52	All SZGR 2.0 genes in this pathway
CHEOK RESPONSE TO MERCAPTOPURINE DN	22	15	All SZGR 2.0 genes in this pathway
ASTON MAJOR DEPRESSIVE DISORDER DN	160	110	All SZGR 2.0 genes in this pathway
MANALO HYPOXIA UP	207	145	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
LINDVALL IMMORTALIZED BY TERT DN	80	56	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 48HR DN	504	323	All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN	434	302	All SZGR 2.0 genes in this pathway
WALLACE PROSTATE CANCER RACE UP	299	167	All SZGR 2.0 genes in this pathway
ACEVEDO METHYLATED IN LIVER CANCER DN	940	425	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN	1080	713	All SZGR 2.0 genes in this pathway
RATTENBACHER BOUND BY CELF1	467	251	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-10	2039	2046	1A,m8	hsa-miR-10a	UACCCUGUAGAUCCGAAUUUGUG
miR-10	2039	2046	1A,m8	hsa-miR-10b	UACCCUGUAGAACCGAAUUUGU
miR-124.1	1331	1337	m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	1331	1337	1A	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	1331	1337	1A	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-128	5355	5361	1A	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	5355	5361	1A	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-137	5561	5568	1A,m8	hsa-miR-137	UAUUGCUUAAGAAUACGCGUAG
miR-141/200a	5697	5703	m8	hsa-miR-141	UAACACUGUCUGGUAAAGAUGG
miR-141/200a	5697	5703	m8	hsa-miR-200a	UAACACUGUCUGGUAACGAUGU
miR-150	5581	5587	1A	hsa-miR-150	UCUCCCAACCCUUGUACCAGUG
miR-182	5730	5736	m8	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-190	1252	1259	1A,m8	hsa-miR-190	UGAUAUGUUUGAUAUAUUAGGU
miR-200bc/429	4860	4866	1A	hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU
miR-27	5355	5362	1A,m8	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	5355	5362	1A,m8	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-329	1095	1101	m8	hsa-miR-329^brain	AACACACCUGGUUAACCUCUUU
miR-339	2038	2044	m8	hsa-miR-339	UCCCUGUCCUCCAGGAGCUCA
miR-370	6110	6116	m8	hsa-miR-370^brain	GCCUGCUGGGGUGGAACCUGG
miR-381	6238	6244	1A	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-9	1578	1584	m8	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: NFASC