Gene Page: ARL5A
Summary ?
GeneID | 26225 |
Symbol | ARL5A |
Synonyms | ARFLP5|ARL5 |
Description | ADP ribosylation factor like GTPase 5A |
Reference | MIM:608960|HGNC:HGNC:696|HPRD:12343| |
Gene type | protein-coding |
Map location | 2q23.3 |
Pascal p-value | 0.054 |
Sherlock p-value | 0.706 |
Fetal beta | 0.64 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.02395 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg15228671 | 2 | 152685130 | ARL5A | 3.79E-8 | -0.006 | 1.09E-5 | DMG:Jaffe_2016 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs4491879 | chr3 | 189373908 | ARL5A | 26225 | 0.08 | trans | ||
rs4505678 | chr3 | 189374356 | ARL5A | 26225 | 0.16 | trans | ||
rs917836 | chr18 | 20053367 | ARL5A | 26225 | 0.08 | trans | ||
rs12326929 | chr18 | 70864592 | ARL5A | 26225 | 0.16 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0005525 | GTP binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007264 | small GTPase mediated signal transduction | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005622 | intracellular | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
CHANDRAN METASTASIS TOP50 DN | 45 | 26 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
WANG LMO4 TARGETS UP | 372 | 227 | All SZGR 2.0 genes in this pathway |
MARKEY RB1 CHRONIC LOF DN | 118 | 78 | All SZGR 2.0 genes in this pathway |
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN | 584 | 395 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS DN | 637 | 377 | All SZGR 2.0 genes in this pathway |
WEI MYCN TARGETS WITH E BOX | 795 | 478 | All SZGR 2.0 genes in this pathway |
MORI SMALL PRE BII LYMPHOCYTE UP | 86 | 57 | All SZGR 2.0 genes in this pathway |
SANA TNF SIGNALING DN | 90 | 57 | All SZGR 2.0 genes in this pathway |
TRACEY RESISTANCE TO IFNA2 DN | 32 | 23 | All SZGR 2.0 genes in this pathway |
BILD CTNNB1 ONCOGENIC SIGNATURE | 82 | 52 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN | 911 | 527 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN | 1011 | 592 | All SZGR 2.0 genes in this pathway |
GAVIN FOXP3 TARGETS CLUSTER P3 | 160 | 103 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 TARGETS UP | 673 | 430 | All SZGR 2.0 genes in this pathway |
MARTINEZ TP53 TARGETS UP | 602 | 364 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 AND TP53 TARGETS UP | 601 | 369 | All SZGR 2.0 genes in this pathway |
GOLDRATH ANTIGEN RESPONSE | 346 | 192 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS DN | 366 | 257 | All SZGR 2.0 genes in this pathway |
LEE RECENT THYMIC EMIGRANT | 227 | 128 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS UP | 518 | 299 | All SZGR 2.0 genes in this pathway |
CHANDRAN METASTASIS DN | 306 | 191 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
let-7/98 | 473 | 479 | 1A | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
miR-129-5p | 63 | 69 | m8 | hsa-miR-129brain | CUUUUUGCGGUCUGGGCUUGC |
hsa-miR-129-5p | CUUUUUGCGGUCUGGGCUUGCU | ||||
miR-181 | 339 | 345 | m8 | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
miR-200bc/429 | 2256 | 2262 | 1A | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU | ||||
miR-338 | 41 | 47 | 1A | hsa-miR-338brain | UCCAGCAUCAGUGAUUUUGUUGA |
miR-450 | 63 | 69 | 1A | hsa-miR-450 | UUUUUGCGAUGUGUUCCUAAUA |
miR-539 | 229 | 235 | 1A | hsa-miR-539 | GGAGAAAUUAUCCUUGGUGUGU |
miR-543 | 340 | 347 | 1A,m8 | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.