SZGR2

Summary ?

GeneID	266727
Symbol	MDGA1
Synonyms	GPIM\|MAMDC3
Description	MAM domain containing glycosylphosphatidylinositol anchor 1
Reference	MIM:609626\|HGNC:HGNC:19267\|Ensembl:ENSG00000112139\|HPRD:14374\|Vega:OTTHUMG00000014626
Gene type	protein-coding
Map location	6p21
Pascal p-value	0.031
Sherlock p-value	0.865
Fetal beta	0.207
DMG	1 (# studies)
eGene	Cerebellar Hemisphere Cerebellum Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	2
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_I	Genome scan meta-analysis	Psr: 0.033
GSMA_IIE	Genome scan meta-analysis (European-ancestry samples)	Psr: 0.04433
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 4

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg21041911	6	37673439	MDGA1	9.83E-11	-0.012	4.49E-7	DMG:Jaffe_2016
cg03356760	6	37665051	MDGA1	5.42E-9	-0.016	3E-6	DMG:Jaffe_2016

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs16890367	chr6	38078448	MDGA1	266727	0.04	cis
rs17392743	chr1	54764240	MDGA1	266727	0.11	trans
rs6687849	chr1	175904808	MDGA1	266727	0.01	trans
rs2481653	chr1	176044120	MDGA1	266727	0.05	trans
rs2502827	chr1	176044216	MDGA1	266727	1.037E-4	trans
rs12405921	chr1	206695730	MDGA1	266727	0.01	trans
rs17572651	chr1	218943612	MDGA1	266727	0	trans
rs16829545	chr2	151977407	MDGA1	266727	9.864E-12	trans
rs3845734	chr2	171125572	MDGA1	266727	1.266E-5	trans
rs7584986	chr2	184111432	MDGA1	266727	2.161E-11	trans
rs6807632	chr3	111395567	MDGA1	266727	0.05	trans
rs17762315	chr5	76807576	MDGA1	266727	5.228E-4	trans
rs7729096	chr5	76835927	MDGA1	266727	0.03	trans
rs1368303	chr5	147672388	MDGA1	266727	3.868E-4	trans
rs17079498	chr8	3018343	MDGA1	266727	0.13	trans
rs11139334	chr9	84209393	MDGA1	266727	0.07	trans
rs2766987	chr9	113667956	MDGA1	266727	0.11	trans
rs2393316	chr10	59333070	MDGA1	266727	0.17	trans
rs7996604	chr13	42224412	MDGA1	266727	0.14	trans
rs1629937	chr14	77059671	MDGA1	266727	0.12	trans
rs17104720	chr14	77127308	MDGA1	266727	0	trans
rs6574467	chr14	79179744	MDGA1	266727	0.1	trans
rs10146003	chr14	79191170	MDGA1	266727	0.1	trans
rs16955618	chr15	29937543	MDGA1	266727	2.589E-29	trans
snp_a-1830894		0	MDGA1	266727	0.11	trans
rs1041786	chr21	22617710	MDGA1	266727	0	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003674	molecular_function	ND		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007420	brain development	ISS	Brain (GO term level: 7)	15019943
GO:0001764	neuron migration	ISS	neuron (GO term level: 8)	-
GO:0021527	spinal cord association neuron differentiation	ISS	neuron (GO term level: 9)	15019943
GO:0007399	nervous system development	IEA	neurite (GO term level: 5)	-
GO:0007275	multicellular organismal development	IEA		-
GO:0030154	cell differentiation	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0016020	membrane	IEA		-
GO:0005886	plasma membrane	IEA		-
GO:0046658	anchored to plasma membrane	IDA		15922729

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
BENPORATH EED TARGETS	1062	725	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR	681	420	All SZGR 2.0 genes in this pathway
MARIADASON RESPONSE TO BUTYRATE SULINDAC 6	52	32	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
CHYLA CBFA2T3 TARGETS UP	387	225	All SZGR 2.0 genes in this pathway
KASLER HDAC7 TARGETS 2 DN	32	23	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-103/107	590	596	1A	hsa-miR-103^brain	AGCAGCAUUGUACAGGGCUAUGA
miR-103/107	590	596	1A	hsa-miR-107^brain	AGCAGCAUUGUACAGGGCUAUCA
miR-124.1	3099	3105	1A	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-141/200a	4840	4846	m8	hsa-miR-141	UAACACUGUCUGGUAAAGAUGG
miR-141/200a	4840	4846	m8	hsa-miR-200a	UAACACUGUCUGGUAACGAUGU
miR-18	273	279	m8	hsa-miR-18a	UAAGGUGCAUCUAGUGCAGAUA
miR-18	273	279	m8	hsa-miR-18b	UAAGGUGCAUCUAGUGCAGUUA
miR-218	246	253	1A,m8	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU
miR-218	246	253	1A,m8	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU
miR-485-5p	4749	4755	m8	hsa-miR-485-5p	AGAGGCUGGCCGUGAUGAAUUC
miR-9	42	48	m8	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA
miR-9	42	48	m8	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: MDGA1