SZGR2

Summary ?

GeneID	2915
Symbol	GRM5
Synonyms	GPRC1E\|MGLUR5\|PPP1R86\|mGlu5
Description	glutamate receptor, metabotropic 5
Reference	MIM:604102\|HGNC:HGNC:4597\|Ensembl:ENSG00000168959\|
Gene type	protein-coding
Map location	11q14.3
Pascal p-value	0.154
Fetal beta	-0.473
Support	GPCR SIGNALLING G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.human_mGluR5 G2Cdb.humanNRC G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets Potential synaptic genes

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Association	A combined odds ratio method (Sun et al. 2008), association studies	1	Link to SZGene
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 2
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.104

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
MARCH6	0.95	0.97
KIF1B	0.95	0.96
KIAA1219	0.95	0.96
PCNX	0.95	0.96
DENND5B	0.95	0.96
PUM2	0.94	0.96
AP1G1	0.94	0.96
WHSC1L1	0.94	0.96
DYRK1A	0.94	0.96
AVL9	0.94	0.96

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
FXYD1	-0.75	-0.84
AF347015.31	-0.73	-0.83
MT-CO2	-0.72	-0.84
HIGD1B	-0.72	-0.84
HSD17B14	-0.71	-0.76
AF347015.33	-0.70	-0.79
TLCD1	-0.70	-0.79
AC021016.1	-0.70	-0.79
TSC22D4	-0.70	-0.75
MT-CYB	-0.70	-0.80

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004872	receptor activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007268	synaptic transmission	TAS	neuron, Synap, Neurotransmitter (GO term level: 6)	7908515
GO:0007206	metabotropic glutamate receptor, phospholipase C activating pathway	TAS	glutamate (GO term level: 10)	7908515
GO:0007186	G-protein coupled receptor protein signaling pathway	IEA		-
GO:0007165	signal transduction	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0016021	integral to membrane	IEA		-
GO:0005886	plasma membrane	IEA		-
GO:0005887	integral to plasma membrane	TAS		7908515

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG CALCIUM SIGNALING PATHWAY	178	134	All SZGR 2.0 genes in this pathway
KEGG NEUROACTIVE LIGAND RECEPTOR INTERACTION	272	195	All SZGR 2.0 genes in this pathway
KEGG GAP JUNCTION	90	68	All SZGR 2.0 genes in this pathway
KEGG LONG TERM POTENTIATION	70	57	All SZGR 2.0 genes in this pathway
KEGG LONG TERM DEPRESSION	70	53	All SZGR 2.0 genes in this pathway
KEGG HUNTINGTONS DISEASE	185	109	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP	1821	933	All SZGR 2.0 genes in this pathway
SAKAI CHRONIC HEPATITIS VS LIVER CANCER DN	36	24	All SZGR 2.0 genes in this pathway
HILLION HMGA1B TARGETS	92	68	All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS PTEN DN	353	226	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER SURVIVAL DN	113	76	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 30MIN DN	150	99	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 4HR DN	254	158	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-133	460	467	1A,m8	hsa-miR-133a	UUGGUCCCCUUCAACCAGCUGU
miR-133	460	467	1A,m8	hsa-miR-133b	UUGGUCCCCUUCAACCAGCUA
miR-181	428	435	1A,m8	hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
miR-182	774	780	m8	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-30-5p	381	387	m8	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-330	294	300	m8	hsa-miR-330^brain	GCAAAGCACACGGCCUGCAGAGA
miR-493-5p	431	437	m8	hsa-miR-493-5p	UUGUACAUGGUAGGCUUUCAUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: GRM5