Gene Page: HK3
Summary ?
| GeneID | 3101 |
| Symbol | HK3 |
| Synonyms | HKIII|HXK3 |
| Description | hexokinase 3 |
| Reference | MIM:142570|HGNC:HGNC:4925|Ensembl:ENSG00000160883|HPRD:00806|Vega:OTTHUMG00000130855 |
| Gene type | protein-coding |
| Map location | 5q35.2 |
| Pascal p-value | 0.611 |
| Fetal beta | 0.126 |
| eGene | Frontal Cortex BA9 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.0276 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| HLA-DRB1 | 0.82 | 0.82 |
| ISCU | 0.73 | 0.68 |
| HLA-DPA1 | 0.72 | 0.79 |
| ANXA11 | 0.72 | 0.75 |
| CD74 | 0.72 | 0.79 |
| HLA-DRA | 0.72 | 0.77 |
| GYG1 | 0.71 | 0.77 |
| ART3 | 0.71 | 0.62 |
| CEBPB | 0.71 | 0.69 |
| ATG7 | 0.71 | 0.69 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| KIAA1949 | -0.47 | -0.53 |
| PDE9A | -0.46 | -0.60 |
| SH3BP2 | -0.46 | -0.58 |
| TUBB2B | -0.45 | -0.58 |
| VAV2 | -0.45 | -0.47 |
| NKIRAS2 | -0.45 | -0.44 |
| PKN1 | -0.45 | -0.52 |
| ZNF311 | -0.45 | -0.50 |
| ZNF300 | -0.44 | -0.46 |
| ZNF551 | -0.44 | -0.46 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0005524 | ATP binding | IEA | - | |
| GO:0005524 | ATP binding | NAS | - | |
| GO:0004396 | hexokinase activity | EXP | 7150652 | |
| GO:0004396 | hexokinase activity | IEA | - | |
| GO:0004396 | hexokinase activity | NAS | - | |
| GO:0004190 | aspartic-type endopeptidase activity | IEA | - | |
| GO:0016740 | transferase activity | IEA | - | |
| GO:0016301 | kinase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006508 | proteolysis | IEA | - | |
| GO:0006096 | glycolysis | IEA | - | |
| GO:0006096 | glycolysis | NAS | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005829 | cytosol | EXP | 7150652 | |
| GO:0016020 | membrane | NAS | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG GLYCOLYSIS GLUCONEOGENESIS | 62 | 41 | All SZGR 2.0 genes in this pathway |
| KEGG FRUCTOSE AND MANNOSE METABOLISM | 34 | 23 | All SZGR 2.0 genes in this pathway |
| KEGG GALACTOSE METABOLISM | 26 | 22 | All SZGR 2.0 genes in this pathway |
| KEGG STARCH AND SUCROSE METABOLISM | 52 | 33 | All SZGR 2.0 genes in this pathway |
| KEGG AMINO SUGAR AND NUCLEOTIDE SUGAR METABOLISM | 44 | 30 | All SZGR 2.0 genes in this pathway |
| KEGG INSULIN SIGNALING PATHWAY | 137 | 103 | All SZGR 2.0 genes in this pathway |
| KEGG TYPE II DIABETES MELLITUS | 47 | 41 | All SZGR 2.0 genes in this pathway |
| REACTOME TRANSMEMBRANE TRANSPORT OF SMALL MOLECULES | 413 | 270 | All SZGR 2.0 genes in this pathway |
| REACTOME SLC MEDIATED TRANSMEMBRANE TRANSPORT | 241 | 157 | All SZGR 2.0 genes in this pathway |
| REACTOME GLUCOSE TRANSPORT | 38 | 29 | All SZGR 2.0 genes in this pathway |
| REACTOME METABOLISM OF CARBOHYDRATES | 247 | 154 | All SZGR 2.0 genes in this pathway |
| TAKEDA TARGETS OF NUP98 HOXA9 FUSION 8D DN | 205 | 127 | All SZGR 2.0 genes in this pathway |
| ROSS AML WITH MLL FUSIONS | 78 | 45 | All SZGR 2.0 genes in this pathway |
| VERHAAK AML WITH NPM1 MUTATED UP | 183 | 111 | All SZGR 2.0 genes in this pathway |
| ZHENG BOUND BY FOXP3 | 491 | 310 | All SZGR 2.0 genes in this pathway |
| VANTVEER BREAST CANCER ESR1 DN | 240 | 153 | All SZGR 2.0 genes in this pathway |
| CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
| MARTENS TRETINOIN RESPONSE UP | 857 | 456 | All SZGR 2.0 genes in this pathway |
| VERHAAK GLIOBLASTOMA MESENCHYMAL | 216 | 130 | All SZGR 2.0 genes in this pathway |
| CHYLA CBFA2T3 TARGETS UP | 387 | 225 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-137 | 177 | 183 | 1A | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.