Gene Page: IGLL1
Summary ?
GeneID | 3543 |
Symbol | IGLL1 |
Synonyms | 14.1|AGM2|CD179b|IGL1|IGL5|IGLJ14.1|IGLL|IGO|IGVPB|VPREB2 |
Description | immunoglobulin lambda like polypeptide 1 |
Reference | MIM:146770|HGNC:HGNC:5870|Ensembl:ENSG00000128322|HPRD:00905|Vega:OTTHUMG00000150673 |
Gene type | protein-coding |
Map location | 22q11.23 |
Pascal p-value | 0.03 |
Fetal beta | -0.13 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
CV:PheWAS | Phenome-wide association studies (PheWAS) | 157 SNPs associated with schizophrenia | 1 |
GSMA_I | Genome scan meta-analysis | Psr: 0.031 |
Section I. Genetics and epigenetics annotation
CV:PheWAS
SNP ID | Chromosome | Position | Allele | P | Function | Gene | Up/Down Distance |
---|---|---|---|---|---|---|---|
rs140174 | 22 | 0 | null | 1.587 | IGLL1 | null |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0006955 | immune response | NAS | 2501791 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005576 | extracellular region | IEA | - | |
GO:0016020 | membrane | NAS | 2501791 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG PRIMARY IMMUNODEFICIENCY | 35 | 28 | All SZGR 2.0 genes in this pathway |
HOLLMANN APOPTOSIS VIA CD40 DN | 267 | 178 | All SZGR 2.0 genes in this pathway |
GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN | 493 | 298 | All SZGR 2.0 genes in this pathway |
WILCOX RESPONSE TO PROGESTERONE DN | 66 | 44 | All SZGR 2.0 genes in this pathway |
GAL LEUKEMIC STEM CELL DN | 244 | 153 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 8D UP | 157 | 91 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 10D UP | 194 | 122 | All SZGR 2.0 genes in this pathway |
RHEIN ALL GLUCOCORTICOID THERAPY DN | 362 | 238 | All SZGR 2.0 genes in this pathway |
JAATINEN HEMATOPOIETIC STEM CELL UP | 316 | 190 | All SZGR 2.0 genes in this pathway |
WANG BARRETTS ESOPHAGUS UP | 51 | 27 | All SZGR 2.0 genes in this pathway |
RASHI RESPONSE TO IONIZING RADIATION 5 | 147 | 89 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 2B | 392 | 251 | All SZGR 2.0 genes in this pathway |
WATTEL AUTONOMOUS THYROID ADENOMA DN | 55 | 29 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
MORI PRE BI LYMPHOCYTE UP | 80 | 54 | All SZGR 2.0 genes in this pathway |
MORI LARGE PRE BII LYMPHOCYTE UP | 86 | 49 | All SZGR 2.0 genes in this pathway |
MORI IMMATURE B LYMPHOCYTE DN | 90 | 55 | All SZGR 2.0 genes in this pathway |
HADDAD B LYMPHOCYTE PROGENITOR | 293 | 193 | All SZGR 2.0 genes in this pathway |
KUMAR TARGETS OF MLL AF9 FUSION | 405 | 264 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS LATE PROGENITOR | 544 | 307 | All SZGR 2.0 genes in this pathway |
MCCABE BOUND BY HOXC6 | 469 | 239 | All SZGR 2.0 genes in this pathway |
MCCABE HOXC6 TARGETS CANCER UP | 31 | 23 | All SZGR 2.0 genes in this pathway |
AGUIRRE PANCREATIC CANCER COPY NUMBER DN | 238 | 145 | All SZGR 2.0 genes in this pathway |
HOFFMANN PRE BI TO LARGE PRE BII LYMPHOCYTE DN | 75 | 61 | All SZGR 2.0 genes in this pathway |
VALK AML WITH CEBPA | 37 | 27 | All SZGR 2.0 genes in this pathway |
HOSHIDA LIVER CANCER SUBCLASS S1 | 237 | 159 | All SZGR 2.0 genes in this pathway |
CHYLA CBFA2T3 TARGETS UP | 387 | 225 | All SZGR 2.0 genes in this pathway |
CERIBELLI GENES INACTIVE AND BOUND BY NFY | 45 | 27 | All SZGR 2.0 genes in this pathway |
MAEKAWA ATF2 TARGETS | 24 | 19 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-22 | 156 | 162 | 1A | hsa-miR-22brain | AAGCUGCCAGUUGAAGAACUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.