Gene Page: NBR1
Summary ?
| GeneID | 4077 |
| Symbol | NBR1 |
| Synonyms | 1A1-3B|IAI3B|M17S2|MIG19 |
| Description | neighbor of BRCA1 gene 1 |
| Reference | MIM:166945|HGNC:HGNC:6746|Ensembl:ENSG00000188554|HPRD:01326|Vega:OTTHUMG00000180878 |
| Gene type | protein-coding |
| Map location | 17q21.31 |
| Pascal p-value | 0.01 |
| Sherlock p-value | 0.365 |
| eGene | Cerebellar Hemisphere Cerebellum Myers' cis & trans |
| Support | Ascano FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0244 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs2850413 | chr4 | 107959343 | NBR1 | 4077 | 0.14 | trans | ||
| rs6128541 | chr20 | 57917688 | NBR1 | 4077 | 0.13 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0046872 | metal ion binding | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| PARENT MTOR SIGNALING UP | 567 | 375 | All SZGR 2.0 genes in this pathway |
| NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN | 634 | 384 | All SZGR 2.0 genes in this pathway |
| SOTIRIOU BREAST CANCER GRADE 1 VS 3 DN | 52 | 34 | All SZGR 2.0 genes in this pathway |
| THUM SYSTOLIC HEART FAILURE UP | 423 | 283 | All SZGR 2.0 genes in this pathway |
| DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
| WANG LMO4 TARGETS DN | 352 | 225 | All SZGR 2.0 genes in this pathway |
| TIEN INTESTINE PROBIOTICS 24HR DN | 214 | 133 | All SZGR 2.0 genes in this pathway |
| KIM WT1 TARGETS DN | 459 | 276 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE EPIDERMIS DN | 508 | 354 | All SZGR 2.0 genes in this pathway |
| FARMER BREAST CANCER APOCRINE VS LUMINAL | 326 | 213 | All SZGR 2.0 genes in this pathway |
| LIANG HEMATOPOIESIS STEM CELL NUMBER SMALL VS HUGE DN | 33 | 22 | All SZGR 2.0 genes in this pathway |
| PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
| NUYTTEN EZH2 TARGETS DN | 1024 | 594 | All SZGR 2.0 genes in this pathway |
| RICKMAN METASTASIS UP | 344 | 180 | All SZGR 2.0 genes in this pathway |
| BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
| BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
| BENPORATH MYC MAX TARGETS | 775 | 494 | All SZGR 2.0 genes in this pathway |
| SHEN SMARCA2 TARGETS UP | 424 | 268 | All SZGR 2.0 genes in this pathway |
| MORI PRE BI LYMPHOCYTE DN | 77 | 49 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 6HR UP | 953 | 554 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 24HR UP | 783 | 442 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY FOXP3 STIMULATED | 1022 | 619 | All SZGR 2.0 genes in this pathway |
| RUIZ TNC TARGETS UP | 153 | 107 | All SZGR 2.0 genes in this pathway |
| AGUIRRE PANCREATIC CANCER COPY NUMBER UP | 298 | 174 | All SZGR 2.0 genes in this pathway |
| DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
| KARLSSON TGFB1 TARGETS DN | 207 | 139 | All SZGR 2.0 genes in this pathway |
| MARTENS BOUND BY PML RARA FUSION | 456 | 287 | All SZGR 2.0 genes in this pathway |
| RAO BOUND BY SALL4 | 227 | 149 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-200bc/429 | 1273 | 1279 | 1A | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
| hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
| hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU | ||||
| hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC | ||||
| hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
| hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU | ||||
| miR-299-5p | 1376 | 1382 | 1A | hsa-miR-299-5p | UGGUUUACCGUCCCACAUACAU |
| miR-369-3p | 1274 | 1280 | m8 | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.