Gene Page: MAP1A
Summary ?
GeneID | 4130 |
Symbol | MAP1A |
Synonyms | MAP1L|MTAP1A |
Description | microtubule associated protein 1A |
Reference | MIM:600178|HGNC:HGNC:6835|Ensembl:ENSG00000166963|HPRD:02549|Vega:OTTHUMG00000059756 |
Gene type | protein-coding |
Map location | 15q15.3 |
Pascal p-value | 3.367E-4 |
Fetal beta | -3.219 |
eGene | Myers' cis & trans |
Support | STRUCTURAL PLASTICITY G2Cdb.human_mGluR5 G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets Potential synaptic genes |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.7246 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs4634107 | chr3 | 186341392 | MAP1A | 4130 | 0.1 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
BCAS1 | 0.96 | 0.97 |
MOBP | 0.93 | 0.94 |
KIF1C | 0.91 | 0.89 |
PAQR6 | 0.90 | 0.93 |
SEPT4 | 0.89 | 0.90 |
TP53INP2 | 0.87 | 0.86 |
FOXO4 | 0.86 | 0.81 |
PLEKHB1 | 0.85 | 0.93 |
ZFP57 | 0.85 | 0.87 |
DAAM2 | 0.82 | 0.87 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
PARP6 | -0.67 | -0.78 |
GSTA4 | -0.67 | -0.81 |
PPP3CC | -0.66 | -0.79 |
SUPV3L1 | -0.66 | -0.78 |
DUSP12 | -0.66 | -0.79 |
UBE2E3 | -0.66 | -0.77 |
MED19 | -0.66 | -0.78 |
STMN1 | -0.65 | -0.80 |
MLLT11 | -0.65 | -0.78 |
CDC42 | -0.65 | -0.78 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | IPI | 12812986 | |
GO:0005198 | structural molecule activity | NAS | 8812494 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005874 | microtubule | IEA | - | |
GO:0005875 | microtubule associated complex | TAS | 8812494 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 1 DN | 378 | 231 | All SZGR 2.0 genes in this pathway |
CONCANNON APOPTOSIS BY EPOXOMICIN UP | 239 | 157 | All SZGR 2.0 genes in this pathway |
LUI THYROID CANCER PAX8 PPARG UP | 44 | 29 | All SZGR 2.0 genes in this pathway |
OUELLET CULTURED OVARIAN CANCER INVASIVE VS LMP DN | 35 | 20 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 2B | 392 | 251 | All SZGR 2.0 genes in this pathway |
PETRETTO BLOOD PRESSURE UP | 12 | 8 | All SZGR 2.0 genes in this pathway |
SHEN SMARCA2 TARGETS DN | 357 | 212 | All SZGR 2.0 genes in this pathway |
ROSS AML WITH PML RARA FUSION | 77 | 62 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS EARLY PROGENITOR | 532 | 309 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS LATE PROGENITOR | 544 | 307 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
SESTO RESPONSE TO UV C2 | 54 | 39 | All SZGR 2.0 genes in this pathway |
KAYO AGING MUSCLE UP | 244 | 165 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 14HR DN | 298 | 200 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 18HR DN | 178 | 121 | All SZGR 2.0 genes in this pathway |
LEIN LOCALIZED TO PROXIMAL DENDRITES | 37 | 26 | All SZGR 2.0 genes in this pathway |
VALK AML WITH FLT3 ITD | 40 | 22 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 30MIN DN | 150 | 99 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 4HR DN | 254 | 158 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS CONFLUENT | 567 | 365 | All SZGR 2.0 genes in this pathway |
WIERENGA STAT5A TARGETS UP | 217 | 131 | All SZGR 2.0 genes in this pathway |
WIERENGA STAT5A TARGETS GROUP1 | 136 | 76 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE EARLY LATE | 317 | 190 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-1/206 | 927 | 934 | 1A,m8 | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC | ||||
miR-181 | 582 | 588 | m8 | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
miR-199 | 962 | 968 | m8 | hsa-miR-199a | CCCAGUGUUCAGACUACCUGUUC |
hsa-miR-199b | CCCAGUGUUUAGACUAUCUGUUC | ||||
miR-218 | 699 | 705 | 1A | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
miR-26 | 600 | 606 | 1A | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
miR-34/449 | 876 | 882 | m8 | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
miR-34b | 877 | 883 | m8 | hsa-miR-34b | UAGGCAGUGUCAUUAGCUGAUUG |
miR-377 | 912 | 918 | m8 | hsa-miR-377 | AUCACACAAAGGCAACUUUUGU |
miR-409-3p | 926 | 932 | m8 | hsa-miR-409-3p | CGAAUGUUGCUCGGUGAACCCCU |
miR-491 | 1308 | 1314 | m8 | hsa-miR-491brain | AGUGGGGAACCCUUCCAUGAGGA |
miR-9 | 193 | 199 | m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.