Gene Page: PAK3
Summary ?
GeneID | 5063 |
Symbol | PAK3 |
Synonyms | MRX30|MRX47|OPHN3|PAK-3|PAK3beta|bPAK|beta-PAK |
Description | p21 protein (Cdc42/Rac)-activated kinase 3 |
Reference | MIM:300142|HGNC:HGNC:8592|Ensembl:ENSG00000077264|HPRD:02142|Vega:OTTHUMG00000022202 |
Gene type | protein-coding |
Map location | Xq23 |
Sherlock p-value | 0.934 |
Fetal beta | -0.126 |
Support | Potential synaptic genes |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
OAT | 0.75 | 0.79 |
AAGAB | 0.74 | 0.77 |
RSRC1 | 0.74 | 0.71 |
AUH | 0.71 | 0.66 |
SUCLA2 | 0.70 | 0.71 |
TBK1 | 0.70 | 0.68 |
ATP1B1 | 0.70 | 0.74 |
NDRG4 | 0.70 | 0.71 |
PFKP | 0.70 | 0.70 |
C13orf1 | 0.70 | 0.71 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.21 | -0.40 | -0.14 |
AF347015.18 | -0.37 | -0.14 |
FAM159B | -0.36 | -0.33 |
AF347015.2 | -0.32 | -0.14 |
AC100783.1 | -0.32 | -0.22 |
CLEC3B | -0.31 | -0.31 |
AC098691.2 | -0.31 | -0.19 |
SIGIRR | -0.31 | -0.37 |
IL32 | -0.30 | -0.10 |
AF347015.8 | -0.30 | -0.11 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0000287 | magnesium ion binding | IEA | - | |
GO:0005524 | ATP binding | IEA | - | |
GO:0004674 | protein serine/threonine kinase activity | IEA | - | |
GO:0016740 | transferase activity | IEA | - | |
GO:0017124 | SH3 domain binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006468 | protein amino acid phosphorylation | IEA | - | |
GO:0007275 | multicellular organismal development | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG ERBB SIGNALING PATHWAY | 87 | 71 | All SZGR 2.0 genes in this pathway |
KEGG AXON GUIDANCE | 129 | 103 | All SZGR 2.0 genes in this pathway |
KEGG FOCAL ADHESION | 201 | 138 | All SZGR 2.0 genes in this pathway |
KEGG T CELL RECEPTOR SIGNALING PATHWAY | 108 | 89 | All SZGR 2.0 genes in this pathway |
KEGG REGULATION OF ACTIN CYTOSKELETON | 216 | 144 | All SZGR 2.0 genes in this pathway |
KEGG RENAL CELL CARCINOMA | 70 | 60 | All SZGR 2.0 genes in this pathway |
BIOCARTA AGR PATHWAY | 36 | 31 | All SZGR 2.0 genes in this pathway |
SIG PIP3 SIGNALING IN CARDIAC MYOCTES | 67 | 54 | All SZGR 2.0 genes in this pathway |
SIG CHEMOTAXIS | 45 | 37 | All SZGR 2.0 genes in this pathway |
SIG REGULATION OF THE ACTIN CYTOSKELETON BY RHO GTPASES | 35 | 25 | All SZGR 2.0 genes in this pathway |
ST INTEGRIN SIGNALING PATHWAY | 82 | 62 | All SZGR 2.0 genes in this pathway |
ST T CELL SIGNAL TRANSDUCTION | 45 | 33 | All SZGR 2.0 genes in this pathway |
PID P38 ALPHA BETA PATHWAY | 31 | 25 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN | 770 | 415 | All SZGR 2.0 genes in this pathway |
STREICHER LSM1 TARGETS UP | 44 | 34 | All SZGR 2.0 genes in this pathway |
WONG ENDMETRIUM CANCER DN | 82 | 53 | All SZGR 2.0 genes in this pathway |
RASHI RESPONSE TO IONIZING RADIATION 5 | 147 | 89 | All SZGR 2.0 genes in this pathway |
JAZAG TGFB1 SIGNALING VIA SMAD4 DN | 66 | 38 | All SZGR 2.0 genes in this pathway |
DING LUNG CANCER MUTATED SIGNIFICANTLY | 26 | 22 | All SZGR 2.0 genes in this pathway |
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
MUNSHI MULTIPLE MYELOMA UP | 81 | 52 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 20HR UP | 240 | 152 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 16HR UP | 225 | 139 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 18HR UP | 178 | 111 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE INCIPIENT DN | 165 | 106 | All SZGR 2.0 genes in this pathway |
MUELLER PLURINET | 299 | 189 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
SHEDDEN LUNG CANCER GOOD SURVIVAL A12 | 317 | 177 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH INV 16 TRANSLOCATION | 422 | 277 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA PRONEURAL | 177 | 132 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
GOBERT CORE OLIGODENDROCYTE DIFFERENTIATION | 40 | 28 | All SZGR 2.0 genes in this pathway |
RATTENBACHER BOUND BY CELF1 | 467 | 251 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-103/107 | 57 | 63 | 1A | hsa-miR-103brain | AGCAGCAUUGUACAGGGCUAUGA |
hsa-miR-107brain | AGCAGCAUUGUACAGGGCUAUCA | ||||
miR-122 | 317 | 323 | m8 | hsa-miR-122a | UGGAGUGUGACAAUGGUGUUUGU |
miR-149 | 253 | 259 | m8 | hsa-miR-149brain | UCUGGCUCCGUGUCUUCACUCC |
miR-193 | 255 | 261 | 1A | hsa-miR-193a | AACUGGCCUACAAAGUCCCAG |
hsa-miR-193b | AACUGGCCCUCAAAGUCCCGCUUU | ||||
miR-539 | 303 | 309 | 1A | hsa-miR-539 | GGAGAAAUUAUCCUUGGUGUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.