Gene Page: VPS36
Summary ?
GeneID | 51028 |
Symbol | VPS36 |
Synonyms | C13orf9|CGI-145|EAP45 |
Description | vacuolar protein sorting 36 homolog (S. cerevisiae) |
Reference | MIM:610903|HGNC:HGNC:20312|Ensembl:ENSG00000136100|HPRD:12620|Vega:OTTHUMG00000016964 |
Gene type | protein-coding |
Map location | 13q14.3 |
Pascal p-value | 0.095 |
Sherlock p-value | 0.01 |
Fetal beta | 0.683 |
DMG | 1 (# studies) |
eGene | Meta |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg17164340 | 13 | 53025003 | VPS36 | 5.12E-8 | -0.021 | 1.35E-5 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0008289 | lipid binding | IEA | - | |
GO:0043130 | ubiquitin binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0006350 | transcription | IEA | - | |
GO:0015031 | protein transport | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - | |
GO:0005737 | cytoplasm | IEA | - | |
GO:0005764 | lysosome | IEA | - | |
GO:0005770 | late endosome | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG ENDOCYTOSIS | 183 | 132 | All SZGR 2.0 genes in this pathway |
REACTOME MEMBRANE TRAFFICKING | 129 | 74 | All SZGR 2.0 genes in this pathway |
REACTOME ENDOSOMAL SORTING COMPLEX REQUIRED FOR TRANSPORT ESCRT | 27 | 15 | All SZGR 2.0 genes in this pathway |
IGARASHI ATF4 TARGETS DN | 90 | 65 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT AND CANCER BOX4 DN | 32 | 22 | All SZGR 2.0 genes in this pathway |
DOUGLAS BMI1 TARGETS DN | 314 | 188 | All SZGR 2.0 genes in this pathway |
IWANAGA CARCINOGENESIS BY KRAS DN | 120 | 81 | All SZGR 2.0 genes in this pathway |
CHANDRAN METASTASIS DN | 306 | 191 | All SZGR 2.0 genes in this pathway |
GABRIELY MIR21 TARGETS | 289 | 187 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE LATE | 1137 | 655 | All SZGR 2.0 genes in this pathway |
RAO BOUND BY SALL4 ISOFORM A | 182 | 108 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-134 | 2710 | 2716 | 1A | hsa-miR-134brain | UGUGACUGGUUGACCAGAGGG |
miR-29 | 2107 | 2113 | m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
miR-485-3p | 2859 | 2865 | 1A | hsa-miR-485-3p | GUCAUACACGGCUCUCCUCUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.