Gene Page: INSIG2

Summary ?
GeneID51141
SymbolINSIG2
Synonyms-
Descriptioninsulin induced gene 2
ReferenceMIM:608660|HGNC:HGNC:20452|Ensembl:ENSG00000125629|HPRD:16361|Vega:OTTHUMG00000058518
Gene typeprotein-coding
Map location2q14.2
Pascal p-value0.067
Fetal beta-0.394

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
PMID:cooccurHigh-throughput literature-searchSystematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_IGenome scan meta-analysisPsr: 0.0004 
GSMA_IIAGenome scan meta-analysis (All samples)Psr: 0.00755 
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophreniasClick to show details

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0008202steroid metabolic processIEA-
GO:0008203cholesterol metabolic processIEA-
GO:0006629lipid metabolic processIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005789endoplasmic reticulum membraneIEA-
GO:0005783endoplasmic reticulumIEA-
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
PRAMOONJAGO SOX4 TARGETS UP 5238All SZGR 2.0 genes in this pathway
ELVIDGE HYPOXIA UP 171112All SZGR 2.0 genes in this pathway
ELVIDGE HYPOXIA BY DMOG UP 13085All SZGR 2.0 genes in this pathway
ELVIDGE HIF1A TARGETS DN 9158All SZGR 2.0 genes in this pathway
ELVIDGE HIF1A AND HIF2A TARGETS DN 10472All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 17811082All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK 1442892All SZGR 2.0 genes in this pathway
GROSS HYPOXIA VIA HIF1A DN 11078All SZGR 2.0 genes in this pathway
GROSS HYPOXIA VIA ELK3 AND HIF1A UP 142104All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS UP 769437All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS UP 1037673All SZGR 2.0 genes in this pathway
BENPORATH CYCLING GENES 648385All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS UP 424268All SZGR 2.0 genes in this pathway
FRASOR RESPONSE TO ESTRADIOL DN 8252All SZGR 2.0 genes in this pathway
MENSE HYPOXIA UP 9871All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS LATE PROGENITOR 544307All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK DN 318220All SZGR 2.0 genes in this pathway
DAZARD UV RESPONSE CLUSTER G6 153112All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS DN 314188All SZGR 2.0 genes in this pathway
RIGGINS TAMOXIFEN RESISTANCE DN 220147All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER DN 540340All SZGR 2.0 genes in this pathway
BOCHKIS FOXA2 TARGETS 425261All SZGR 2.0 genes in this pathway
GRADE COLON VS RECTAL CANCER UP 3821All SZGR 2.0 genes in this pathway
WANG TUMOR INVASIVENESS DN 210128All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS DN 442275All SZGR 2.0 genes in this pathway
CHEN LIVER METABOLISM QTL CIS 9340All SZGR 2.0 genes in this pathway
CHIANG LIVER CANCER SUBCLASS CTNNB1 UP 176110All SZGR 2.0 genes in this pathway
ZEMBUTSU SENSITIVITY TO VINBLASTINE 1812All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE S 16286All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS NOT VIA AKT1 DN 8861All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS VIA AKT1 DN 8251All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE EARLY LATE 317190All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS UP 682433All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3 824528All SZGR 2.0 genes in this pathway
KRIEG HYPOXIA NOT VIA KDM3A 770480All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 227149All SZGR 2.0 genes in this pathway
BOUDOUKHA BOUND BY IGF2BP2 11159All SZGR 2.0 genes in this pathway
SMIRNOV RESPONSE TO IR 2HR DN 5535All SZGR 2.0 genes in this pathway
SMIRNOV RESPONSE TO IR 6HR DN 11469All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF 516308All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-30-5p16451651m8hsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA
miR-375156815741Ahsa-miR-375UUUGUUCGUUCGGCUCGCGUGA
miR-37616361642m8hsa-miR-376aAUCAUAGAGGAAAAUCCACGU
hsa-miR-376bAUCAUAGAGGAAAAUCCAUGUU
miR-377145114571Ahsa-miR-377AUCACACAAAGGCAACUUUUGU
miR-96331337m8hsa-miR-96brainUUUGGCACUAGCACAUUUUUGC