Gene Page: PDE3B
Summary ?
| GeneID | 5140 |
| Symbol | PDE3B |
| Synonyms | HcGIP1|cGIPDE1 |
| Description | phosphodiesterase 3B |
| Reference | MIM:602047|HGNC:HGNC:8779|Ensembl:ENSG00000152270|HPRD:03626|Vega:OTTHUMG00000165898 |
| Gene type | protein-coding |
| Map location | 11p15.1 |
| Pascal p-value | 0.495 |
| Fetal beta | 1.114 |
| eGene | Myers' cis & trans |
| Support | CompositeSet |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DNM:Fromer_2014 | Whole Exome Sequencing analysis | This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA. | |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0078 |
Section I. Genetics and epigenetics annotation
DNM table
| Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
|---|---|---|---|---|---|---|---|---|---|---|---|
| PDE3B | chr11 | 14854346 | C | T | NM_000922 | p.725R>C | missense | Schizophrenia | DNM:Fromer_2014 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs7370564 | 0 | PDE3B | 5140 | 0.18 | trans | |||
| rs2187675 | chr16 | 12628451 | PDE3B | 5140 | 0.13 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| RASL10A | 0.68 | 0.69 |
| TTC9B | 0.61 | 0.57 |
| CORO1A | 0.61 | 0.69 |
| YRDC | 0.60 | 0.58 |
| TWF2 | 0.59 | 0.62 |
| KCNMB4 | 0.59 | 0.62 |
| MEIS3P2 | 0.57 | 0.59 |
| TMEM198 | 0.56 | 0.61 |
| LASS4 | 0.56 | 0.55 |
| UBL7 | 0.56 | 0.52 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| NSBP1 | -0.47 | -0.56 |
| AF347015.26 | -0.46 | -0.43 |
| RAB13 | -0.45 | -0.53 |
| EYA2 | -0.44 | -0.48 |
| C9orf61 | -0.44 | -0.51 |
| ALDH7A1 | -0.44 | -0.46 |
| PBXIP1 | -0.43 | -0.46 |
| AL139819.3 | -0.43 | -0.49 |
| ADSSL1 | -0.43 | -0.45 |
| AF347015.18 | -0.42 | -0.47 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004119 | cGMP-inhibited cyclic-nucleotide phosphodiesterase activity | TAS | 8884271 | |
| GO:0016787 | hydrolase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007165 | signal transduction | IEA | - | |
| GO:0031018 | endocrine pancreas development | IEA | - | |
| GO:0042593 | glucose homeostasis | IEA | - | |
| GO:0050796 | regulation of insulin secretion | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG PURINE METABOLISM | 159 | 96 | All SZGR 2.0 genes in this pathway |
| KEGG INSULIN SIGNALING PATHWAY | 137 | 103 | All SZGR 2.0 genes in this pathway |
| KEGG PROGESTERONE MEDIATED OOCYTE MATURATION | 86 | 59 | All SZGR 2.0 genes in this pathway |
| BIOCARTA NO1 PATHWAY | 33 | 24 | All SZGR 2.0 genes in this pathway |
| REACTOME INSULIN RECEPTOR SIGNALLING CASCADE | 87 | 64 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
| REACTOME GPCR DOWNSTREAM SIGNALING | 805 | 368 | All SZGR 2.0 genes in this pathway |
| REACTOME G ALPHA S SIGNALLING EVENTS | 121 | 82 | All SZGR 2.0 genes in this pathway |
| REACTOME CGMP EFFECTS | 19 | 13 | All SZGR 2.0 genes in this pathway |
| REACTOME NITRIC OXIDE STIMULATES GUANYLATE CYCLASE | 25 | 19 | All SZGR 2.0 genes in this pathway |
| REACTOME PLATELET HOMEOSTASIS | 78 | 49 | All SZGR 2.0 genes in this pathway |
| REACTOME PKB MEDIATED EVENTS | 29 | 23 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY INSULIN RECEPTOR | 108 | 72 | All SZGR 2.0 genes in this pathway |
| REACTOME HEMOSTASIS | 466 | 331 | All SZGR 2.0 genes in this pathway |
| REACTOME PI3K CASCADE | 71 | 51 | All SZGR 2.0 genes in this pathway |
| CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA UP | 177 | 110 | All SZGR 2.0 genes in this pathway |
| HUTTMANN B CLL POOR SURVIVAL UP | 276 | 187 | All SZGR 2.0 genes in this pathway |
| SCIBETTA KDM5B TARGETS DN | 81 | 55 | All SZGR 2.0 genes in this pathway |
| VANHARANTA UTERINE FIBROID WITH 7Q DELETION DN | 36 | 23 | All SZGR 2.0 genes in this pathway |
| TERAMOTO OPN TARGETS CLUSTER 7 | 19 | 16 | All SZGR 2.0 genes in this pathway |
| SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN | 584 | 395 | All SZGR 2.0 genes in this pathway |
| PASQUALUCCI LYMPHOMA BY GC STAGE DN | 165 | 104 | All SZGR 2.0 genes in this pathway |
| ROSS AML WITH PML RARA FUSION | 77 | 62 | All SZGR 2.0 genes in this pathway |
| THEILGAARD NEUTROPHIL AT SKIN WOUND DN | 225 | 163 | All SZGR 2.0 genes in this pathway |
| MOREAUX MULTIPLE MYELOMA BY TACI UP | 412 | 249 | All SZGR 2.0 genes in this pathway |
| VERHAAK AML WITH NPM1 MUTATED DN | 246 | 180 | All SZGR 2.0 genes in this pathway |
| KAYO AGING MUSCLE UP | 244 | 165 | All SZGR 2.0 genes in this pathway |
| RODWELL AGING KIDNEY DN | 145 | 88 | All SZGR 2.0 genes in this pathway |
| GAVIN FOXP3 TARGETS CLUSTER P3 | 160 | 103 | All SZGR 2.0 genes in this pathway |
| HELLER HDAC TARGETS SILENCED BY METHYLATION DN | 281 | 179 | All SZGR 2.0 genes in this pathway |
| WALLACE PROSTATE CANCER RACE DN | 88 | 42 | All SZGR 2.0 genes in this pathway |
| MARZEC IL2 SIGNALING DN | 36 | 24 | All SZGR 2.0 genes in this pathway |
| FUJII YBX1 TARGETS DN | 202 | 132 | All SZGR 2.0 genes in this pathway |
| MITSIADES RESPONSE TO APLIDIN UP | 439 | 257 | All SZGR 2.0 genes in this pathway |
| BONOME OVARIAN CANCER SURVIVAL OPTIMAL DEBULKING | 246 | 152 | All SZGR 2.0 genes in this pathway |
| CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
| VALK AML CLUSTER 2 | 29 | 14 | All SZGR 2.0 genes in this pathway |
| JISON SICKLE CELL DISEASE DN | 181 | 97 | All SZGR 2.0 genes in this pathway |
| MARSON FOXP3 TARGETS DN | 54 | 38 | All SZGR 2.0 genes in this pathway |
| STAMBOLSKY RESPONSE TO VITAMIN D3 UP | 84 | 48 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
| LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
| TORCHIA TARGETS OF EWSR1 FLI1 FUSION DN | 321 | 200 | All SZGR 2.0 genes in this pathway |
| PEDERSEN METASTASIS BY ERBB2 ISOFORM 7 | 403 | 240 | All SZGR 2.0 genes in this pathway |
| DURAND STROMA NS UP | 162 | 103 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-186 | 772 | 779 | 1A,m8 | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
| miR-205 | 760 | 766 | m8 | hsa-miR-205 | UCCUUCAUUCCACCGGAGUCUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.