Summary ?
GeneID55626
SymbolAMBRA1
SynonymsDCAF3|WDR94
Descriptionautophagy/beclin-1 regulator 1
ReferenceMIM:611359|HGNC:HGNC:25990|Ensembl:ENSG00000110497|HPRD:10975|Vega:OTTHUMG00000166500
Gene typeprotein-coding
Map location11p11.2
Pascal p-value5.791E-10
Sherlock p-value0.475
Fetal beta-0.489
eGeneMyers' cis & trans

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:GWASdbGenome-wide Association StudiesGWASdb records for schizophrenia
CV:PGCnpGenome-wide Association StudyGWAS
PMID:cooccurHigh-throughput literature-searchSystematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophreniasClick to show details
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP IDChromosomePositioneGeneGene Entrez IDpvalueqvalueTSS distanceeQTL type
rs17142575chr66790864AMBRA1556260.17trans
rs1568778chr7109250931AMBRA1556260.2trans
rs711457chr7109264996AMBRA1556260.08trans
rs16877935chr831216487AMBRA1556260.14trans
rs16877941chr831219122AMBRA1556260.14trans
rs737377chr831248987AMBRA1556260.07trans
rs16877965chr831252303AMBRA1556260.08trans
rs11235411chr1171688034AMBRA1556260.04trans
rs9914334chr1769795668AMBRA1556260.09trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
GenePearson's Correlation Spearman's Correlation
DNAJC120.660.72
VWA5A0.650.71
ADK0.650.70
SCOC0.640.68
MAOA0.630.65
BCHE0.630.60
PDHB0.630.68
CCNE10.630.67
SCP20.630.65
PAM0.630.70
Top 10 negatively co-expressed genes
GenePearson's Correlation Spearman's Correlation
SCUBE1-0.47-0.39
SATB2-0.45-0.28
NHSL1-0.45-0.28
SLA-0.44-0.17
TTC28-0.43-0.21
WDR86-0.42-0.41
MPPED1-0.42-0.26
ADRA2A-0.42-0.22
GJC1-0.41-0.25
NAV2-0.41-0.21

Section III. Gene Ontology annotation

Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007399nervous system developmentIEAneurite (GO term level: 5)-
GO:0006914autophagyIEA-
GO:0007275multicellular organismal developmentIEA-
GO:0030154cell differentiationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005737cytoplasmIDA17589504 
GO:0031410cytoplasmic vesicleIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
PARENT MTOR SIGNALING UP 567375All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 17811082All SZGR 2.0 genes in this pathway
DARWICHE SKIN TUMOR PROMOTER DN 185115All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK LOW DN 165107All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK HIGH DN 180110All SZGR 2.0 genes in this pathway
DARWICHE SQUAMOUS CELL CARCINOMA DN 181107All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS 957597All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED 1229713All SZGR 2.0 genes in this pathway
MCCABE BOUND BY HOXC6 469239All SZGR 2.0 genes in this pathway
ACEVEDO METHYLATED IN LIVER CANCER DN 940425All SZGR 2.0 genes in this pathway
CHUNG BLISTER CYTOTOXICITY UP 13484All SZGR 2.0 genes in this pathway
MIZUSHIMA AUTOPHAGOSOME FORMATION 1915All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-200bc/4297397461A,m8hsa-miR-200bUAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200cUAAUACUGCCGGGUAAUGAUGG
hsa-miR-429UAAUACUGUCUGGUAAAACCGU
miR-23914920m8hsa-miR-23abrainAUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrainAUCACAUUGCCAGGGAUUACC
miR-3239149201Ahsa-miR-323brainGCACAUUACACGGUCGACCUCU
miR-485-3p9079131Ahsa-miR-485-3pGUCAUACACGGCUCUCCUCUCU
miR-73503571A,m8hsa-miR-7SZUGGAAGACUAGUGAUUUUGUUG
miR-999910061A,m8hsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA