Gene Page: TMEM127
Summary ?
GeneID | 55654 |
Symbol | TMEM127 |
Synonyms | - |
Description | transmembrane protein 127 |
Reference | MIM:613403|HGNC:HGNC:26038|HPRD:07917| |
Gene type | protein-coding |
Map location | 2q11.2 |
Pascal p-value | 1.328E-5 |
Sherlock p-value | 0.631 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
GSMA_I | Genome scan meta-analysis | Psr: 0.0004 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
HAHTOLA MYCOSIS FUNGOIDES CD4 UP | 64 | 46 | All SZGR 2.0 genes in this pathway |
PEREZ TP53 TARGETS | 1174 | 695 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS UP | 769 | 437 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
HEDENFALK BREAST CANCER BRCA1 VS BRCA2 | 163 | 113 | All SZGR 2.0 genes in this pathway |
DOUGLAS BMI1 TARGETS DN | 314 | 188 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS SILENCED BY METHYLATION UP | 461 | 298 | All SZGR 2.0 genes in this pathway |
COULOUARN TEMPORAL TGFB1 SIGNATURE DN | 138 | 99 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE LATE | 1137 | 655 | All SZGR 2.0 genes in this pathway |
IVANOVSKA MIR106B TARGETS | 90 | 56 | All SZGR 2.0 genes in this pathway |
TERAO AOX4 TARGETS HG UP | 28 | 20 | All SZGR 2.0 genes in this pathway |
DELACROIX RARG BOUND MEF | 367 | 231 | All SZGR 2.0 genes in this pathway |
DELACROIX RAR BOUND ES | 462 | 273 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-148/152 | 1048 | 1054 | 1A | hsa-miR-148a | UCAGUGCACUACAGAACUUUGU |
hsa-miR-152brain | UCAGUGCAUGACAGAACUUGGG | ||||
hsa-miR-148b | UCAGUGCAUCACAGAACUUUGU | ||||
miR-17-5p/20/93.mr/106/519.d | 515 | 522 | 1A,m8 | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
miR-181 | 1263 | 1270 | 1A,m8 | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
miR-182 | 1923 | 1929 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-29 | 1028 | 1034 | m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
miR-326 | 61 | 67 | m8 | hsa-miR-326 | CCUCUGGGCCCUUCCUCCAG |
miR-370 | 81 | 87 | m8 | hsa-miR-370brain | GCCUGCUGGGGUGGAACCUGG |
miR-495 | 2214 | 2220 | m8 | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
miR-96 | 1923 | 1929 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.