Gene Page: POLE4

Summary
GeneID  56655
Symbol  POLE4
Synonyms  p12
Description  polymerase (DNA-directed), epsilon 4 (p12 subunit)
See related  HGNC:18755|MIM:607269|Ensembl:ENSG00000115350|HPRD:16238|
Locus tag  -
Gene type  protein-coding
Map location  2p12
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
ExpressionExpressionP value: 1.533 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003887DNA-directed DNA polymerase activityTAS10801849 
GO:0005515protein bindingIPI10801849 
GO:0016779nucleotidyltransferase activityIEA-
GO:0016740transferase activityIEA-
GO:0043565sequence-specific DNA bindingIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005622intracellularIEA-
GO:0005634nucleusTAS10801849 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
POLE2DPE2polymerase (DNA directed), epsilon 2 (p59 subunit)-HPRD10801849 
POLE3CHARAC17 | CHRAC17 | YBL1 | p17polymerase (DNA directed), epsilon 3 (p17 subunit)-HPRD10801849 
RAD17CCYC | FLJ41520 | HRAD17 | R24L | RAD17SP | RAD24RAD17 homolog (S. pombe)Affinity Capture-WesternBioGRID14500819 
 
Pathway annotation
Pathway namePathway size# SZGR genes in pathwayInfo
KEGG_PURINE_METABOLISM 15996All SZGR genes in this pathway
KEGG_PYRIMIDINE_METABOLISM 9853All SZGR genes in this pathway
KEGG_DNA_REPLICATION 3621All SZGR genes in this pathway
KEGG_BASE_EXCISION_REPAIR 3522All SZGR genes in this pathway
KEGG_NUCLEOTIDE_EXCISION_REPAIR 4425All SZGR genes in this pathway
FULCHER_INFLAMMATORY_RESPONSE_LECTIN_VS_LPS_UP 579346All SZGR genes in this pathway
KAUFFMANN_MELANOMA_RELAPSE_UP 6125All SZGR genes in this pathway
LOPEZ_MBD_TARGETS 957597All SZGR genes in this pathway
WEI_MYCN_TARGETS_WITH_E_BOX 795478All SZGR genes in this pathway
KAUFFMANN_DNA_REPAIR_GENES 230137All SZGR genes in this pathway
KAUFFMANN_DNA_REPLICATION_GENES 14787All SZGR genes in this pathway
LINDVALL_IMMORTALIZED_BY_TERT_UP 7848All SZGR genes in this pathway
RODWELL_AGING_KIDNEY_NO_BLOOD_UP 222139All SZGR genes in this pathway
KRIGE_RESPONSE_TO_TOSEDOSTAT_6HR_DN 911527All SZGR genes in this pathway
KRIGE_RESPONSE_TO_TOSEDOSTAT_24HR_DN 1011592All SZGR genes in this pathway
MARSON_BOUND_BY_FOXP3_UNSTIMULATED 1229713All SZGR genes in this pathway
MARSON_BOUND_BY_E2F4_UNSTIMULATED 728415All SZGR genes in this pathway
JOHNSTONE_PARVB_TARGETS_3_DN 918550All SZGR genes in this pathway
LEE_BMP2_TARGETS_DN 882538All SZGR genes in this pathway
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-3206773m8hsa-miR-320AAAAGCUGGGUUGAGAGGGCGAA
miR-71921991A,m8hsa-miR-7SZUGGAAGACUAGUGAUUUUGUUG
hsa-miR-7SZUGGAAGACUAGUGAUUUUGUUG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.