Gene Page: POLE4
Summary ?
| GeneID | 56655 |
| Symbol | POLE4 |
| Synonyms | YHHQ1|p12 |
| Description | polymerase (DNA) epsilon 4, accessory subunit |
| Reference | MIM:607269|HGNC:HGNC:18755|HPRD:16238| |
| Gene type | protein-coding |
| Map location | 2p12 |
| Pascal p-value | 0.996 |
| Sherlock p-value | 9.291E-5 |
| DMG | 1 (# studies) |
| eGene | Myers' cis & trans Meta |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Nishioka_2013 | Genome-wide DNA methylation analysis | The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. | 1 |
| Expression | Meta-analysis of gene expression | P value: 1.533 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg21954994 | 2 | 75039479 | POLE4 | -0.021 | 0.36 | DMG:Nishioka_2013 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs2503875 | chr10 | 43814048 | POLE4 | 56655 | 0.12 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003887 | DNA-directed DNA polymerase activity | TAS | 10801849 | |
| GO:0005515 | protein binding | IPI | 10801849 | |
| GO:0016779 | nucleotidyltransferase activity | IEA | - | |
| GO:0016740 | transferase activity | IEA | - | |
| GO:0043565 | sequence-specific DNA binding | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005622 | intracellular | IEA | - | |
| GO:0005634 | nucleus | TAS | 10801849 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG PURINE METABOLISM | 159 | 96 | All SZGR 2.0 genes in this pathway |
| KEGG PYRIMIDINE METABOLISM | 98 | 53 | All SZGR 2.0 genes in this pathway |
| KEGG DNA REPLICATION | 36 | 21 | All SZGR 2.0 genes in this pathway |
| KEGG BASE EXCISION REPAIR | 35 | 22 | All SZGR 2.0 genes in this pathway |
| KEGG NUCLEOTIDE EXCISION REPAIR | 44 | 25 | All SZGR 2.0 genes in this pathway |
| FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP | 579 | 346 | All SZGR 2.0 genes in this pathway |
| KAUFFMANN MELANOMA RELAPSE UP | 61 | 25 | All SZGR 2.0 genes in this pathway |
| LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
| WEI MYCN TARGETS WITH E BOX | 795 | 478 | All SZGR 2.0 genes in this pathway |
| KAUFFMANN DNA REPAIR GENES | 230 | 137 | All SZGR 2.0 genes in this pathway |
| KAUFFMANN DNA REPLICATION GENES | 147 | 87 | All SZGR 2.0 genes in this pathway |
| LINDVALL IMMORTALIZED BY TERT UP | 78 | 48 | All SZGR 2.0 genes in this pathway |
| RODWELL AGING KIDNEY NO BLOOD UP | 222 | 139 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 6HR DN | 911 | 527 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 24HR DN | 1011 | 592 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY E2F4 UNSTIMULATED | 728 | 415 | All SZGR 2.0 genes in this pathway |
| JOHNSTONE PARVB TARGETS 3 DN | 918 | 550 | All SZGR 2.0 genes in this pathway |
| LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-320 | 67 | 73 | m8 | hsa-miR-320 | AAAAGCUGGGUUGAGAGGGCGAA |
| miR-7 | 192 | 199 | 1A,m8 | hsa-miR-7SZ | UGGAAGACUAGUGAUUUUGUUG |
| hsa-miR-7SZ | UGGAAGACUAGUGAUUUUGUUG | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.