Gene Page: RYR1

Summary
GeneID  6261
Symbol  RYR1
Synonyms  CCO|MHS|MHS1|RYDR|RYR|SKRR
Description  ryanodine receptor 1 (skeletal)
See related  HGNC:10483|MIM:180901|Ensembl:ENSG00000196218|HPRD:01618|
Locus tag  -
Gene type  protein-coding
Map location  19q13.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0024 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004872receptor activityIEA-
GO:0005509calcium ion bindingIEA-
GO:0005515protein bindingIEA-
GO:0005245voltage-gated calcium channel activityIEA-
GO:0005216ion channel activityIEA-
GO:0005219ryanodine-sensitive calcium-release channel activityIEA-
GO:0015278calcium-release channel activityTAS9030597 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006816calcium ion transportTAS7511586 
GO:0006811ion transportIEA-
GO:0006936muscle contractionTAS9030597 
GO:0006874cellular calcium ion homeostasisIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005790smooth endoplasmic reticulumTAS2298749 
GO:0005624membrane fractionIEA-
GO:0005737cytoplasmIDA11206130 
GO:0005938cell cortexIDA11206130 
GO:0005886plasma membraneIDA11206130 
GO:0005887integral to plasma membraneTAS2298749 
GO:0014802terminal cisternaISS1374404 
GO:0030315T-tubuleIEA-
GO:0030314junctional membrane complexIEA-
GO:0031674I bandIDA11206130 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
CACNA1SCACNL1A3 | CCHL1A3 | Cav1.1 | HOKPP | MHS5 | hypoPPcalcium channel, voltage-dependent, L type, alpha 1S subunit-HPRD9199552 
CALM1CALML2 | CAMI | DD132 | PHKDcalmodulin 1 (phosphorylase kinase, delta)-HPRD12509414 
FKBP1AFKBP-12 | FKBP1 | FKBP12 | FKBP12C | PKC12 | PKCI2 | PPIASEFK506 binding protein 1A, 12kDa-HPRD,BioGRID11171121 |11279144 
|12704193|11237759 
HOMER1HOMER | HOMER1A | HOMER1B | HOMER1C | SYN47 | Ves-1homer homolog 1 (Drosophila)-HPRD,BioGRID12223488 |12810060 
|14660561 
HOMER2ACPD | CPD | HOMER-2 | HOMER2A | HOMER2B | Vesl-2homer homolog 2 (Drosophila)-HPRD,BioGRID12223488 
HOMER3HOMER-3homer homolog 3 (Drosophila)-HPRD,BioGRID12223488 
RYR1CCO | MHS | MHS1 | RYDR | RYR | SKRRryanodine receptor 1 (skeletal)-HPRD12509414 
RYR2ARVC2 | ARVD2 | VTSIPryanodine receptor 2 (cardiac)-HPRD,BioGRID12213830 
S100A1S100 | S100-alpha | S100AS100 calcium binding protein A1-HPRD,BioGRID9298970 
TRDNDKFZp779I2253 | MGC88285 | TDN | TRISK | TRISK51triadin-HPRD9287354 |9890886 
|10212196 |10531621 
|11069905 
Far Western
Protein-peptide
Reconstituted Complex		BioGRID7721813 |9890886 
|10212196 |14638677 
 
Pathway annotation
Pathway namePathway size# SZGR genes in pathwayInfo
KEGG_CALCIUM_SIGNALING_PATHWAY 178134All SZGR genes in this pathway
KEGG_LONG_TERM_DEPRESSION 7053All SZGR genes in this pathway
ST_MYOCYTE_AD_PATHWAY 2725All SZGR genes in this pathway
ONKEN_UVEAL_MELANOMA_DN 526357All SZGR genes in this pathway
MULLIGHAN_NPM1_SIGNATURE_3_DN 162116All SZGR genes in this pathway
DELYS_THYROID_CANCER_UP 443294All SZGR genes in this pathway
DARWICHE_SKIN_TUMOR_PROMOTER_UP 14296All SZGR genes in this pathway
DARWICHE_PAPILLOMA_RISK_LOW_UP 162104All SZGR genes in this pathway
DARWICHE_PAPILLOMA_RISK_HIGH_UP 147101All SZGR genes in this pathway
DARWICHE_SQUAMOUS_CELL_CARCINOMA_UP 146104All SZGR genes in this pathway
LOPEZ_MBD_TARGETS 957597All SZGR genes in this pathway
CAFFAREL_RESPONSE_TO_THC_24HR_3_DN 138All SZGR genes in this pathway
HASLINGER_B_CLL_WITH_17P13_DELETION 2115All SZGR genes in this pathway
KUMAR_TARGETS_OF_MLL_AF9_FUSION 405264All SZGR genes in this pathway
REN_ALVEOLAR_RHABDOMYOSARCOMA_UP 9864All SZGR genes in this pathway
LU_AGING_BRAIN_UP 262186All SZGR genes in this pathway
KUNINGER_IGF1_VS_PDGFB_TARGETS_UP 8251All SZGR genes in this pathway
MARTINEZ_RB1_TARGETS_UP 673430All SZGR genes in this pathway
MARTINEZ_TP53_TARGETS_DN 593372All SZGR genes in this pathway
MARTINEZ_RB1_AND_TP53_TARGETS_DN 591366All SZGR genes in this pathway
DAIRKEE_CANCER_PRONE_RESPONSE_E2 2821All SZGR genes in this pathway
SMID_BREAST_CANCER_RELAPSE_IN_BONE_DN 315197All SZGR genes in this pathway
SMID_BREAST_CANCER_RELAPSE_IN_LUNG_UP 2110All SZGR genes in this pathway
SMID_BREAST_CANCER_LUMINAL_B_DN 564326All SZGR genes in this pathway
SMID_BREAST_CANCER_BASAL_UP 648398All SZGR genes in this pathway
YAGI_AML_WITH_T_9_11_TRANSLOCATION 13087All SZGR genes in this pathway
MIKKELSEN_MEF_ICP_WITH_H3K27ME3 206108All SZGR genes in this pathway
MIKKELSEN_ES_ICP_WITH_H3K4ME3 718401All SZGR genes in this pathway
HO_LIVER_CANCER_VASCULAR_INVASION 136All SZGR genes in this pathway
TSUTSUMI_FBXW8_TARGETS 95All SZGR genes in this pathway
BRUINS_UVC_RESPONSE_VIA_TP53_GROUP_A 898516All SZGR genes in this pathway
BRUINS_UVC_RESPONSE_VIA_TP53_GROUP_B 549316All SZGR genes in this pathway
PURBEY_TARGETS_OF_CTBP1_NOT_SATB1_DN 448282All SZGR genes in this pathway
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124/50635421A,m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-228591m8hsa-miR-22brainAAGCUGCCAGUUGAAGAACUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.