SZGR2

Summary ?

GeneID	6261
Symbol	RYR1
Synonyms	CCO\|MHS\|MHS1\|PPP1R137\|RYDR\|RYR\|RYR-1\|SKRR
Description	ryanodine receptor 1
Reference	MIM:180901\|HGNC:HGNC:10483\|Ensembl:ENSG00000196218\|HPRD:01618\|Vega:OTTHUMG00000182403
Gene type	protein-coding
Map location	19q13.2
Pascal p-value	0.032
Sherlock p-value	0.081
eGene	Myers' cis & trans
Support	INTRACELLULAR SIGNAL TRANSDUCTION

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0024

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs6461405	chr7	19255956	RYR1	6261		0.1		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004872	receptor activity	IEA		-
GO:0005509	calcium ion binding	IEA		-
GO:0005515	protein binding	IEA		-
GO:0005245	voltage-gated calcium channel activity	IEA		-
GO:0005216	ion channel activity	IEA		-
GO:0005219	ryanodine-sensitive calcium-release channel activity	IEA		-
GO:0015278	calcium-release channel activity	TAS		9030597
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006816	calcium ion transport	TAS		7511586
GO:0006811	ion transport	IEA		-
GO:0006936	muscle contraction	TAS		9030597
GO:0006874	cellular calcium ion homeostasis	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005790	smooth endoplasmic reticulum	TAS		2298749
GO:0005624	membrane fraction	IEA		-
GO:0005737	cytoplasm	IDA		11206130
GO:0005938	cell cortex	IDA		11206130
GO:0005886	plasma membrane	IDA		11206130
GO:0005887	integral to plasma membrane	TAS		2298749
GO:0014802	terminal cisterna	ISS		1374404
GO:0030315	T-tubule	IEA		-
GO:0030314	junctional membrane complex	IEA		-
GO:0031674	I band	IDA		11206130

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG CALCIUM SIGNALING PATHWAY	178	134	All SZGR 2.0 genes in this pathway
KEGG LONG TERM DEPRESSION	70	53	All SZGR 2.0 genes in this pathway
ST MYOCYTE AD PATHWAY	27	25	All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA DN	526	357	All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 SIGNATURE 3 DN	162	116	All SZGR 2.0 genes in this pathway
DELYS THYROID CANCER UP	443	294	All SZGR 2.0 genes in this pathway
DARWICHE SKIN TUMOR PROMOTER UP	142	96	All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK LOW UP	162	104	All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK HIGH UP	147	101	All SZGR 2.0 genes in this pathway
DARWICHE SQUAMOUS CELL CARCINOMA UP	146	104	All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS	957	597	All SZGR 2.0 genes in this pathway
CAFFAREL RESPONSE TO THC 24HR 3 DN	13	8	All SZGR 2.0 genes in this pathway
HASLINGER B CLL WITH 17P13 DELETION	21	15	All SZGR 2.0 genes in this pathway
KUMAR TARGETS OF MLL AF9 FUSION	405	264	All SZGR 2.0 genes in this pathway
REN ALVEOLAR RHABDOMYOSARCOMA UP	98	64	All SZGR 2.0 genes in this pathway
LU AGING BRAIN UP	262	186	All SZGR 2.0 genes in this pathway
KUNINGER IGF1 VS PDGFB TARGETS UP	82	51	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP	673	430	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN	593	372	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN	591	366	All SZGR 2.0 genes in this pathway
DAIRKEE CANCER PRONE RESPONSE E2	28	21	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER RELAPSE IN BONE DN	315	197	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER RELAPSE IN LUNG UP	21	10	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER LUMINAL B DN	564	326	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL UP	648	398	All SZGR 2.0 genes in this pathway
YAGI AML WITH T 9 11 TRANSLOCATION	130	87	All SZGR 2.0 genes in this pathway
MIKKELSEN MEF ICP WITH H3K27ME3	206	108	All SZGR 2.0 genes in this pathway
MIKKELSEN ES ICP WITH H3K4ME3	718	401	All SZGR 2.0 genes in this pathway
HO LIVER CANCER VASCULAR INVASION	13	6	All SZGR 2.0 genes in this pathway
TSUTSUMI FBXW8 TARGETS	9	5	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP A	898	516	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP B	549	316	All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 DN	448	282	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124/506	35	42	1A,m8	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	35	42	1A,m8	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-22	85	91	m8	hsa-miR-22^brain	AAGCUGCCAGUUGAAGAACUGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: RYR1