SZGR2

Summary ?

GeneID	6328
Symbol	SCN3A
Synonyms	NAC3\|Nav1.3
Description	sodium voltage-gated channel alpha subunit 3
Reference	MIM:182391\|HGNC:HGNC:10590\|Ensembl:ENSG00000153253\|HPRD:01671\|Vega:OTTHUMG00000044171
Gene type	protein-coding
Map location	2q24
Pascal p-value	0.036
Support	EXCITABILITY

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.02395

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
ISG20	0.67	0.74
S100A4	0.66	0.70
HLA-B	0.64	0.75
HLA-F	0.64	0.79
PLA1A	0.62	0.76
GBP2	0.62	0.72
CFB	0.60	0.71
HLA-C	0.60	0.72
HIGD1B	0.57	0.70
C16orf89	0.57	0.70

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
BLMH	-0.55	-0.76
ARMCX5	-0.55	-0.76
ZNF23	-0.54	-0.76
CSTF3	-0.53	-0.76
PSPC1	-0.53	-0.74
PPP3CC	-0.53	-0.76
SUPV3L1	-0.53	-0.72
GSTA4	-0.53	-0.78
GNL3	-0.53	-0.74
MARK3	-0.53	-0.75

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005244	voltage-gated ion channel activity	IEA		-
GO:0005248	voltage-gated sodium channel activity	NAS		9589372
GO:0031402	sodium ion binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006814	sodium ion transport	NAS		9589372
GO:0006811	ion transport	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0001518	voltage-gated sodium channel complex	NAS		-
GO:0016020	membrane	IEA		-
GO:0016021	integral to membrane	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP	255	177	All SZGR 2.0 genes in this pathway
HOEBEKE LYMPHOID STEM CELL UP	95	64	All SZGR 2.0 genes in this pathway
LEE NEURAL CREST STEM CELL UP	146	99	All SZGR 2.0 genes in this pathway
JAATINEN HEMATOPOIETIC STEM CELL UP	316	190	All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS F UP	185	119	All SZGR 2.0 genes in this pathway
MAHADEVAN IMATINIB RESISTANCE UP	23	15	All SZGR 2.0 genes in this pathway
HADDAD B LYMPHOCYTE PROGENITOR	293	193	All SZGR 2.0 genes in this pathway
HADDAD T LYMPHOCYTE AND NK PROGENITOR DN	63	41	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE INCIPIENT DN	165	106	All SZGR 2.0 genes in this pathway
ZHENG IL22 SIGNALING DN	42	26	All SZGR 2.0 genes in this pathway
LIN NPAS4 TARGETS UP	163	100	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
ASGHARZADEH NEUROBLASTOMA POOR SURVIVAL DN	46	30	All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA PRONEURAL	177	132	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-10	178	184	1A	hsa-miR-10a	UACCCUGUAGAUCCGAAUUUGUG
miR-10	178	184	1A	hsa-miR-10b	UACCCUGUAGAACCGAAUUUGU
miR-132/212	99	105	m8	hsa-miR-212^SZ	UAACAGUCUCCAGUCACGGCC
miR-132/212	99	105	m8	hsa-miR-132^brain	UAACAGUCUACAGCCAUGGUCG
miR-145	66	72	m8	hsa-miR-145	GUCCAGUUUUCCCAGGAAUCCCUU
miR-153	683	689	1A	hsa-miR-153	UUGCAUAGUCACAAAAGUGA
miR-182	90	96	1A	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-183	350	356	1A	hsa-miR-183	UAUGGCACUGGUAGAAUUCACUG
miR-214	227	233	1A	hsa-miR-214^brain	ACAGCAGGCACAGACAGGCAG
miR-223	95	101	m8	hsa-miR-223	UGUCAGUUUGUCAAAUACCCC
miR-24	1977	1983	1A	hsa-miR-24^SZ	UGGCUCAGUUCAGCAGGAACAG
miR-25/32/92/363/367	1824	1830	m8	hsa-miR-25^brain	CAUUGCACUUGUCUCGGUCUGA
				hsa-miR-32	UAUUGCACAUUACUAAGUUGC
				hsa-miR-92	UAUUGCACUUGUCCCGGCCUG
				hsa-miR-367	AAUUGCACUUUAGCAAUGGUGA
				hsa-miR-92b^SZ	UAUUGCACUCGUCCCGGCCUC
miR-30-5p	32	39	1A,m8	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-339	1030	1036	1A	hsa-miR-339	UCCCUGUCCUCCAGGAGCUCA
miR-363	708	714	1A	hsa-miR-363	AUUGCACGGUAUCCAUCUGUAA
miR-379	1593	1599	1A	hsa-miR-379^brain	UGGUAGACUAUGGAACGUA
miR-448	683	689	1A	hsa-miR-448	UUGCAUAUGUAGGAUGUCCCAU
miR-494	697	703	1A	hsa-miR-494^brain	UGAAACAUACACGGGAAACCUCUU
miR-495	1576	1582	1A	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
miR-496	1378	1384	1A	hsa-miR-496	AUUACAUGGCCAAUCUC
miR-496	1378	1384	1A	hsa-miR-496	AUUACAUGGCCAAUCUC
miR-96	90	96	1A	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: SCN3A