SZGR2

Summary ?

GeneID	64399
Symbol	HHIP
Synonyms	HIP
Description	hedgehog interacting protein
Reference	MIM:606178\|HGNC:HGNC:14866\|HPRD:06937\|
Gene type	protein-coding
Map location	4q28-q32
Pascal p-value	0.187
Fetal beta	-2.189
DMG	2 (# studies)
eGene	Cerebellar Hemisphere
Support	Ascano FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Nishioka_2013	Genome-wide DNA methylation analysis	The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls.	2
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	2
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg15319311	4	145568991	HHIP	3.456E-4	-0.554	0.041	DMG:Wockner_2014
cg14580567	4	145567271	HHIP		-0.038	0.32	DMG:Nishioka_2013

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003824	catalytic activity	IEA		-
GO:0005515	protein binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007405	neuroblast proliferation	IEA	neuron (GO term level: 8)	-
GO:0009953	dorsal/ventral pattern formation	IEA		-
GO:0009887	organ morphogenesis	IEA		-
GO:0007165	signal transduction	IEA		-
GO:0040036	regulation of fibroblast growth factor receptor signaling pathway	IEA		-
GO:0030324	lung development	IEA		-
GO:0045879	negative regulation of smoothened signaling pathway	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005576	extracellular region	IEA		-
GO:0005737	cytoplasm	IEA		-
GO:0009986	cell surface	IEA		-
GO:0005886	plasma membrane	IEA		-
GO:0005887	integral to plasma membrane	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG HEDGEHOG SIGNALING PATHWAY	56	42	All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER	328	259	All SZGR 2.0 genes in this pathway
KEGG BASAL CELL CARCINOMA	55	44	All SZGR 2.0 genes in this pathway
PID HEDGEHOG 2PATHWAY	22	17	All SZGR 2.0 genes in this pathway
VECCHI GASTRIC CANCER EARLY DN	367	220	All SZGR 2.0 genes in this pathway
SENESE HDAC1 AND HDAC2 TARGETS UP	238	144	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP	501	327	All SZGR 2.0 genes in this pathway
MOHANKUMAR TLX1 TARGETS DN	193	112	All SZGR 2.0 genes in this pathway
SHETH LIVER CANCER VS TXNIP LOSS PAM5	94	59	All SZGR 2.0 genes in this pathway
SCHLESINGER METHYLATED IN COLON CANCER	10	7	All SZGR 2.0 genes in this pathway
INGRAM SHH TARGETS UP	127	79	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR UP	487	286	All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS	1038	678	All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS	1062	725	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS	652	441	All SZGR 2.0 genes in this pathway
ROZANOV MMP14 TARGETS SUBSET	33	20	All SZGR 2.0 genes in this pathway
ROZANOV MMP14 TARGETS UP	266	171	All SZGR 2.0 genes in this pathway
SANA RESPONSE TO IFNG DN	85	56	All SZGR 2.0 genes in this pathway
AFFAR YY1 TARGETS UP	214	133	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP	673	430	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN	593	372	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN	591	366	All SZGR 2.0 genes in this pathway
LEE EARLY T LYMPHOCYTE UP	107	59	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
HOELZEL NF1 TARGETS UP	139	93	All SZGR 2.0 genes in this pathway
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS UP	259	159	All SZGR 2.0 genes in this pathway
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL DN	308	187	All SZGR 2.0 genes in this pathway
NABA SECRETED FACTORS	344	197	All SZGR 2.0 genes in this pathway
NABA MATRISOME ASSOCIATED	753	411	All SZGR 2.0 genes in this pathway
NABA MATRISOME	1028	559	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-25/32/92/363/367	395	401	m8	hsa-miR-25^brain	CAUUGCACUUGUCUCGGUCUGA
				hsa-miR-32	UAUUGCACAUUACUAAGUUGC
				hsa-miR-92	UAUUGCACUUGUCCCGGCCUG
				hsa-miR-367	AAUUGCACUUUAGCAAUGGUGA
				hsa-miR-92b^SZ	UAUUGCACUCGUCCCGGCCUC
miR-365	33	39	m8	hsa-miR-365	UAAUGCCCCUAAAAAUCCUUAU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: HHIP