Gene Page: SOX1
Summary ?
| GeneID | 6656 |
| Symbol | SOX1 |
| Synonyms | - |
| Description | SRY-box 1 |
| Reference | MIM:602148|HGNC:HGNC:11189|HPRD:03687| |
| Gene type | protein-coding |
| Map location | 13q34 |
| Pascal p-value | 0.128 |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 3 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs7370564 | 0 | SOX1 | 6656 | 0.12 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| LILRA4 | 0.69 | 0.59 |
| CLDND1 | 0.67 | 0.75 |
| C10orf128 | 0.65 | 0.65 |
| CNDP1 | 0.65 | 0.53 |
| SLC31A2 | 0.65 | 0.68 |
| TMEM144 | 0.64 | 0.64 |
| LRP2 | 0.64 | 0.66 |
| LASS2 | 0.64 | 0.75 |
| RNF13 | 0.64 | 0.69 |
| PLA2G7 | 0.63 | 0.62 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| OLFM2 | -0.31 | -0.37 |
| EMID1 | -0.30 | -0.44 |
| TBC1D10A | -0.29 | -0.33 |
| WDR86 | -0.27 | -0.39 |
| SLC29A4 | -0.27 | -0.32 |
| KLHL1 | -0.27 | -0.25 |
| SCUBE1 | -0.27 | -0.40 |
| RPRM | -0.27 | -0.30 |
| PPAPR5 | -0.27 | -0.24 |
| MPPED1 | -0.26 | -0.23 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003700 | transcription factor activity | NAS | 9337405 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0001764 | neuron migration | IEA | neuron (GO term level: 8) | - |
| GO:0030900 | forebrain development | IEA | Brain (GO term level: 8) | - |
| GO:0021884 | forebrain neuron development | IEA | neuron, Brain (GO term level: 11) | - |
| GO:0006355 | regulation of transcription, DNA-dependent | NAS | 9337405 | |
| GO:0006325 | establishment or maintenance of chromatin architecture | NAS | 9337405 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | NAS | 9337405 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| RIZ ERYTHROID DIFFERENTIATION HBZ | 41 | 27 | All SZGR 2.0 genes in this pathway |
| RIZ ERYTHROID DIFFERENTIATION HEMGN | 31 | 21 | All SZGR 2.0 genes in this pathway |
| ROVERSI GLIOMA COPY NUMBER DN | 54 | 37 | All SZGR 2.0 genes in this pathway |
| DAWSON METHYLATED IN LYMPHOMA TCL1 | 59 | 45 | All SZGR 2.0 genes in this pathway |
| HATADA METHYLATED IN LUNG CANCER UP | 390 | 236 | All SZGR 2.0 genes in this pathway |
| BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
| BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
| TESAR ALK TARGETS HUMAN ES 5D UP | 5 | 5 | All SZGR 2.0 genes in this pathway |
| HU GENOTOXIN ACTION DIRECT VS INDIRECT 4HR | 37 | 22 | All SZGR 2.0 genes in this pathway |
| XU GH1 EXOGENOUS TARGETS DN | 120 | 69 | All SZGR 2.0 genes in this pathway |
| TESAR ALK TARGETS EPISC 3D UP | 7 | 7 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3K4ME3 AND H3K27ME3 | 142 | 103 | All SZGR 2.0 genes in this pathway |
| MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN NPC HCP WITH H3K4ME3 AND H3K27ME3 | 210 | 148 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 4HR DN | 254 | 158 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE VIA TP53 GROUP B | 549 | 316 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-139 | 1655 | 1661 | m8 | hsa-miR-139brain | UCUACAGUGCACGUGUCU |
| miR-155 | 1627 | 1634 | 1A,m8 | hsa-miR-155 | UUAAUGCUAAUCGUGAUAGGGG |
| miR-200bc/429 | 256 | 262 | m8 | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
| hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
| hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU | ||||
| miR-221/222 | 1657 | 1663 | 1A | hsa-miR-221brain | AGCUACAUUGUCUGCUGGGUUUC |
| hsa-miR-222brain | AGCUACAUCUGGCUACUGGGUCUC | ||||
| miR-410 | 565 | 571 | m8 | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.