Gene Page: SPI1
Summary ?
| GeneID | 6688 |
| Symbol | SPI1 |
| Synonyms | OF|PU.1|SFPI1|SPI-1|SPI-A |
| Description | Spi-1 proto-oncogene |
| Reference | MIM:165170|HGNC:HGNC:11241|Ensembl:ENSG00000066336|HPRD:01305|Vega:OTTHUMG00000150150 |
| Gene type | protein-coding |
| Map location | 11p11.2 |
| Pascal p-value | 0.01 |
| Fetal beta | -0.077 |
| DMG | 1 (# studies) |
| eGene | Myers' cis & trans Meta |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:vanEijk_2014 | Genome-wide DNA methylation analysis | This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250). | 1 |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg06147863 | 11 | 47400113 | SPI1 | 0.001 | -5.274 | DMG:vanEijk_2014 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs4844714 | chr1 | 208874118 | SPI1 | 6688 | 0.18 | trans | ||
| rs7754123 | chr6 | 132667231 | SPI1 | 6688 | 0.03 | trans | ||
| rs17076272 | chr13 | 22726361 | SPI1 | 6688 | 0.02 | trans | ||
| rs17076274 | chr13 | 22726381 | SPI1 | 6688 | 0.02 | trans | ||
| rs10483856 | chr14 | 74365294 | SPI1 | 6688 | 0.12 | trans | ||
| rs8072151 | chr17 | 50228268 | SPI1 | 6688 | 0.11 | trans | ||
| rs16982879 | chrX | 92924110 | SPI1 | 6688 | 0.09 | trans | ||
| rs7879274 | chrX | 145592957 | SPI1 | 6688 | 0.07 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| PSMA4 | 0.87 | 0.87 |
| UTP11L | 0.87 | 0.87 |
| PSMA3 | 0.87 | 0.86 |
| C4orf27 | 0.87 | 0.88 |
| EAPP | 0.86 | 0.86 |
| PPHLN1 | 0.86 | 0.86 |
| PAK1IP1 | 0.85 | 0.85 |
| C6orf162 | 0.85 | 0.83 |
| BXDC2 | 0.85 | 0.86 |
| DDX50 | 0.85 | 0.84 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.2 | -0.74 | -0.70 |
| MT-CYB | -0.73 | -0.70 |
| MT-CO2 | -0.73 | -0.67 |
| AF347015.8 | -0.73 | -0.68 |
| AF347015.15 | -0.72 | -0.70 |
| AF347015.26 | -0.72 | -0.70 |
| AF347015.33 | -0.72 | -0.68 |
| AF347015.27 | -0.70 | -0.68 |
| AF347015.31 | -0.69 | -0.67 |
| AF347015.9 | -0.66 | -0.68 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003700 | transcription factor activity | IEA | - | |
| GO:0003700 | transcription factor activity | TAS | 2180582 |10867017 | |
| GO:0003723 | RNA binding | IEA | - | |
| GO:0005515 | protein binding | IPI | 10207087 | |
| GO:0016563 | transcription activator activity | IEA | - | |
| GO:0043565 | sequence-specific DNA binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0043011 | myeloid dendritic cell differentiation | IEA | dendrite (GO term level: 10) | - |
| GO:0000122 | negative regulation of transcription from RNA polymerase II promoter | TAS | 10867017 | |
| GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
| GO:0030098 | lymphocyte differentiation | IEA | - | |
| GO:0006350 | transcription | IEA | - | |
| GO:0043193 | positive regulation of gene-specific transcription | IDA | 12833137 | |
| GO:0030851 | granulocyte differentiation | IEA | - | |
| GO:0030225 | macrophage differentiation | IEA | - | |
| GO:0045646 | regulation of erythrocyte differentiation | IMP | 12833137 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | IEA | - |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| ATF1 | EWS-ATF1 | FUS/ATF-1 | TREB36 | activating transcription factor 1 | - | HPRD,BioGRID | 7730336 |
| CEBPA | C/EBP-alpha | CEBP | CCAAT/enhancer binding protein (C/EBP), alpha | - | HPRD,BioGRID | 12091339 |
| CEBPB | C/EBP-beta | CRP2 | IL6DBP | LAP | MGC32080 | NF-IL6 | TCF5 | CCAAT/enhancer binding protein (C/EBP), beta | - | HPRD,BioGRID | 7594592 |
| CEBPE | C/EBP-epsilon | CRP1 | CCAAT/enhancer binding protein (C/EBP), epsilon | C/EBP-epsilon interacts with PU.1. | BIND | 12202480 |
| CREM | ICER | MGC111110 | MGC17881 | MGC41893 | hCREM-2 | cAMP responsive element modulator | - | HPRD,BioGRID | 7730336 |
| CSNK2A1 | CK2A1 | CKII | casein kinase 2, alpha 1 polypeptide | Biochemical Activity | BioGRID | 8632909 |
| ERG | erg-3 | p55 | v-ets erythroblastosis virus E26 oncogene homolog (avian) | - | HPRD | 9681824 |
| ETS1 | ETS-1 | EWSR2 | FLJ10768 | v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) | Reconstituted Complex | BioGRID | 9681824 |
| ETS2 | ETS2IT1 | v-ets erythroblastosis virus E26 oncogene homolog 2 (avian) | Reconstituted Complex | BioGRID | 9681824 |
| ETV1 | DKFZp781L0674 | ER81 | MGC104699 | MGC120533 | MGC120534 | ets variant 1 | Reconstituted Complex | BioGRID | 9681824 |
| FOS | AP-1 | C-FOS | v-fos FBJ murine osteosarcoma viral oncogene homolog | Reconstituted Complex | BioGRID | 9681824 |
| FUS | CHOP | FUS-CHOP | FUS1 | TLS | TLS/CHOP | hnRNP-P2 | fusion (involved in t(12;16) in malignant liposarcoma) | - | HPRD,BioGRID | 9478924 |
| GATA1 | ERYF1 | GF-1 | GF1 | NFE1 | GATA binding protein 1 (globin transcription factor 1) | PU.1 interacts with GATA-1. | BIND | 12202480 |
| GATA2 | MGC2306 | NFE1B | GATA binding protein 2 | - | HPRD,BioGRID | 10411939 |
| IRF4 | LSIRF | MUM1 | interferon regulatory factor 4 | - | HPRD,BioGRID | 10022840 |12372320 |
| IRF8 | H-ICSBP | ICSBP | ICSBP1 | IRF-8 | interferon regulatory factor 8 | - | HPRD | 10734131 |
| JUN | AP-1 | AP1 | c-Jun | jun oncogene | Reconstituted Complex | BioGRID | 9681824 |
| JUN | AP-1 | AP1 | c-Jun | jun oncogene | - | HPRD | 12091339 |
| MAPK8 | JNK | JNK1 | JNK1A2 | JNK21B1/2 | PRKM8 | SAPK1 | mitogen-activated protein kinase 8 | Biochemical Activity | BioGRID | 8632909 |
| MITF | MI | WS2A | bHLHe32 | microphthalmia-associated transcription factor | - | HPRD,BioGRID | 9918847 |
| NFKB1 | DKFZp686C01211 | EBP-1 | KBF1 | MGC54151 | NF-kappa-B | NFKB-p105 | NFKB-p50 | p105 | nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 | - | HPRD | 9094628 |
| NFYA | CBF-A | CBF-B | FLJ11236 | HAP2 | NF-YA | nuclear transcription factor Y, alpha | Reconstituted Complex | BioGRID | 9668064 |
| NONO | NMT55 | NRB54 | P54 | P54NRB | non-POU domain containing, octamer-binding | - | HPRD,BioGRID | 8626664 |
| PRG2 | BMPG | MBP | MBP1 | MGC14537 | proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein) | The MBP-P2 promoter interacts with PU.1. | BIND | 12202480 |
| SPIB | SPI-B | Spi-B transcription factor (Spi-1/PU.1 related) | - | HPRD,BioGRID | 10196196 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG PATHWAYS IN CANCER | 328 | 259 | All SZGR 2.0 genes in this pathway |
| KEGG ACUTE MYELOID LEUKEMIA | 60 | 47 | All SZGR 2.0 genes in this pathway |
| PID IL4 2PATHWAY | 65 | 43 | All SZGR 2.0 genes in this pathway |
| PID REG GR PATHWAY | 82 | 60 | All SZGR 2.0 genes in this pathway |
| PID CMYB PATHWAY | 84 | 61 | All SZGR 2.0 genes in this pathway |
| PID MYC REPRESS PATHWAY | 63 | 52 | All SZGR 2.0 genes in this pathway |
| PID RB 1PATHWAY | 65 | 46 | All SZGR 2.0 genes in this pathway |
| FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP | 579 | 346 | All SZGR 2.0 genes in this pathway |
| GARY CD5 TARGETS UP | 473 | 314 | All SZGR 2.0 genes in this pathway |
| OSMAN BLADDER CANCER UP | 404 | 246 | All SZGR 2.0 genes in this pathway |
| MULLIGHAN MLL SIGNATURE 1 UP | 380 | 236 | All SZGR 2.0 genes in this pathway |
| MULLIGHAN MLL SIGNATURE 2 UP | 418 | 263 | All SZGR 2.0 genes in this pathway |
| TONKS TARGETS OF RUNX1 RUNX1T1 FUSION HSC DN | 187 | 115 | All SZGR 2.0 genes in this pathway |
| MARKEY RB1 CHRONIC LOF DN | 118 | 78 | All SZGR 2.0 genes in this pathway |
| ROVERSI GLIOMA COPY NUMBER UP | 100 | 75 | All SZGR 2.0 genes in this pathway |
| JAZAG TGFB1 SIGNALING VIA SMAD4 DN | 66 | 38 | All SZGR 2.0 genes in this pathway |
| PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
| RICKMAN METASTASIS DN | 261 | 155 | All SZGR 2.0 genes in this pathway |
| SHIN B CELL LYMPHOMA CLUSTER 8 | 36 | 28 | All SZGR 2.0 genes in this pathway |
| BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING | 510 | 309 | All SZGR 2.0 genes in this pathway |
| PARK APL PATHOGENESIS DN | 50 | 35 | All SZGR 2.0 genes in this pathway |
| PARK TRETINOIN RESPONSE AND PML RARA FUSION | 30 | 21 | All SZGR 2.0 genes in this pathway |
| PARK TRETINOIN RESPONSE AND RARA PLZF FUSION | 22 | 14 | All SZGR 2.0 genes in this pathway |
| CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
| ZHAN EARLY DIFFERENTIATION GENES DN | 42 | 29 | All SZGR 2.0 genes in this pathway |
| CROONQUIST NRAS VS STROMAL STIMULATION UP | 41 | 26 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN IPS LCP WITH H3K4ME3 | 174 | 100 | All SZGR 2.0 genes in this pathway |
| FONTAINE FOLLICULAR THYROID ADENOMA DN | 68 | 45 | All SZGR 2.0 genes in this pathway |
| FONTAINE PAPILLARY THYROID CARCINOMA DN | 80 | 53 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN ES LCP WITH H3K4ME3 | 142 | 80 | All SZGR 2.0 genes in this pathway |
| MARTENS BOUND BY PML RARA FUSION | 456 | 287 | All SZGR 2.0 genes in this pathway |
| CHYLA CBFA2T3 TARGETS UP | 387 | 225 | All SZGR 2.0 genes in this pathway |
| PURBEY TARGETS OF CTBP1 NOT SATB1 UP | 344 | 215 | All SZGR 2.0 genes in this pathway |
| HUANG GATA2 TARGETS UP | 149 | 96 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-155 | 46 | 53 | 1A,m8 | hsa-miR-155 | UUAAUGCUAAUCGUGAUAGGGG |
| miR-339 | 73 | 79 | 1A | hsa-miR-339 | UCCCUGUCCUCCAGGAGCUCA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.