Gene Page: ELOVL4
Summary ?
GeneID | 6785 |
Symbol | ELOVL4 |
Synonyms | ADMD|CT118|ISQMR|SCA34|STGD2|STGD3 |
Description | ELOVL fatty acid elongase 4 |
Reference | MIM:605512|HGNC:HGNC:14415|Ensembl:ENSG00000118402|HPRD:05697|Vega:OTTHUMG00000015087 |
Gene type | protein-coding |
Map location | 6q14 |
Pascal p-value | 0.056 |
Sherlock p-value | 0.522 |
Fetal beta | -0.658 |
DMG | 1 (# studies) |
eGene | Cerebellar Hemisphere |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg24859546 | 6 | 80654763 | ELOVL4 | 1.522E-4 | 0.499 | 0.032 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0008020 | G-protein coupled photoreceptor activity | NAS | 11138005 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007601 | visual perception | IEA | - | |
GO:0006633 | fatty acid biosynthetic process | NAS | 11138005 | |
GO:0050896 | response to stimulus | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005789 | endoplasmic reticulum membrane | IEA | - | |
GO:0005575 | cellular_component | ND | - | |
GO:0005783 | endoplasmic reticulum | IEA | - | |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
REACTOME TRIGLYCERIDE BIOSYNTHESIS | 38 | 26 | All SZGR 2.0 genes in this pathway |
REACTOME FATTY ACYL COA BIOSYNTHESIS | 18 | 15 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF LIPIDS AND LIPOPROTEINS | 478 | 302 | All SZGR 2.0 genes in this pathway |
REACTOME FATTY ACID TRIACYLGLYCEROL AND KETONE BODY METABOLISM | 168 | 115 | All SZGR 2.0 genes in this pathway |
REACTOME SYNTHESIS OF VERY LONG CHAIN FATTY ACYL COAS | 14 | 12 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION UP | 552 | 347 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND SERUM DEPRIVATION UP | 211 | 136 | All SZGR 2.0 genes in this pathway |
HUMMERICH SKIN CANCER PROGRESSION DN | 100 | 64 | All SZGR 2.0 genes in this pathway |
KOBAYASHI RESPONSE TO ROMIDEPSIN | 19 | 14 | All SZGR 2.0 genes in this pathway |
SHETH LIVER CANCER VS TXNIP LOSS PAM5 | 94 | 59 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS DN | 1024 | 594 | All SZGR 2.0 genes in this pathway |
ZHAN MULTIPLE MYELOMA CD1 AND CD2 DN | 51 | 32 | All SZGR 2.0 genes in this pathway |
MATSUDA NATURAL KILLER DIFFERENTIATION | 475 | 313 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL UP | 648 | 398 | All SZGR 2.0 genes in this pathway |
LEE DOUBLE POLAR THYMOCYTE | 27 | 17 | All SZGR 2.0 genes in this pathway |
SHEDDEN LUNG CANCER POOR SURVIVAL A6 | 456 | 285 | All SZGR 2.0 genes in this pathway |
WINZEN DEGRADED VIA KHSRP | 100 | 70 | All SZGR 2.0 genes in this pathway |
FOSTER KDM1A TARGETS UP | 266 | 142 | All SZGR 2.0 genes in this pathway |
LIM MAMMARY STEM CELL UP | 489 | 314 | All SZGR 2.0 genes in this pathway |
DURAND STROMA NS UP | 162 | 103 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
let-7/98 | 918 | 924 | m8 | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
miR-124.1 | 11 | 17 | 1A | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
miR-128 | 679 | 685 | m8 | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
miR-217 | 1594 | 1600 | m8 | hsa-miR-217 | UACUGCAUCAGGAACUGAUUGGAU |
miR-218 | 1762 | 1768 | 1A | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
miR-25/32/92/363/367 | 1177 | 1184 | 1A,m8 | hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA |
hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC | ||||
miR-29 | 1197 | 1204 | 1A,m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
miR-329 | 1678 | 1684 | 1A | hsa-miR-329brain | AACACACCUGGUUAACCUCUUU |
miR-409-3p | 1711 | 1717 | m8 | hsa-miR-409-3p | CGAAUGUUGCUCGGUGAACCCCU |
miR-500 | 1176 | 1182 | 1A | hsa-miR-500 | AUGCACCUGGGCAAGGAUUCUG |
miR-9 | 233 | 239 | m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.