Gene Page: BTC
Summary ?
| GeneID | 685 |
| Symbol | BTC |
| Synonyms | - |
| Description | betacellulin |
| Reference | MIM:600345|HGNC:HGNC:1121|HPRD:02643| |
| Gene type | protein-coding |
| Map location | 4q13.3 |
| Pascal p-value | 0.005 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| Expression | Meta-analysis of gene expression | P value: 1.409 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| RPL5 | 0.97 | 0.94 |
| RPL4 | 0.96 | 0.97 |
| NACA | 0.96 | 0.96 |
| ILF2 | 0.96 | 0.95 |
| IGBP1 | 0.96 | 0.96 |
| TUT1 | 0.96 | 0.90 |
| EIF3H | 0.96 | 0.93 |
| C14orf166 | 0.96 | 0.92 |
| RPS8 | 0.95 | 0.86 |
| VPS72 | 0.95 | 0.93 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| HLA-F | -0.69 | -0.76 |
| AIFM3 | -0.67 | -0.74 |
| AF347015.27 | -0.66 | -0.82 |
| FBXO2 | -0.66 | -0.66 |
| AF347015.33 | -0.65 | -0.83 |
| C5orf53 | -0.65 | -0.66 |
| MT-CO2 | -0.64 | -0.81 |
| TINAGL1 | -0.64 | -0.76 |
| ATP10A | -0.64 | -0.72 |
| MT-CYB | -0.64 | -0.82 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005154 | epidermal growth factor receptor binding | TAS | 8144591 | |
| GO:0008083 | growth factor activity | TAS | 8439318 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0008284 | positive regulation of cell proliferation | TAS | 8144591 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005576 | extracellular region | IEA | - | |
| GO:0005625 | soluble fraction | TAS | 8144591 | |
| GO:0016021 | integral to membrane | IEA | - | |
| GO:0005886 | plasma membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG ERBB SIGNALING PATHWAY | 87 | 71 | All SZGR 2.0 genes in this pathway |
| PID ERBB4 PATHWAY | 38 | 32 | All SZGR 2.0 genes in this pathway |
| PID ERBB NETWORK PATHWAY | 15 | 13 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY ERBB4 | 90 | 67 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY ERBB2 | 101 | 78 | All SZGR 2.0 genes in this pathway |
| REACTOME GRB2 EVENTS IN ERBB2 SIGNALING | 22 | 20 | All SZGR 2.0 genes in this pathway |
| REACTOME PI3K EVENTS IN ERBB4 SIGNALING | 38 | 28 | All SZGR 2.0 genes in this pathway |
| REACTOME SHC1 EVENTS IN ERBB4 SIGNALING | 20 | 17 | All SZGR 2.0 genes in this pathway |
| REACTOME PI3K EVENTS IN ERBB2 SIGNALING | 44 | 34 | All SZGR 2.0 genes in this pathway |
| REACTOME NUCLEAR SIGNALING BY ERBB4 | 38 | 30 | All SZGR 2.0 genes in this pathway |
| DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
| MOHANKUMAR TLX1 TARGETS DN | 193 | 112 | All SZGR 2.0 genes in this pathway |
| KIM MYCN AMPLIFICATION TARGETS UP | 92 | 64 | All SZGR 2.0 genes in this pathway |
| GOTZMANN EPITHELIAL TO MESENCHYMAL TRANSITION DN | 206 | 136 | All SZGR 2.0 genes in this pathway |
| GEORGES TARGETS OF MIR192 AND MIR215 | 893 | 528 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR | 681 | 420 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 TARGETS UP | 673 | 430 | All SZGR 2.0 genes in this pathway |
| MARTINEZ TP53 TARGETS UP | 602 | 364 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 AND TP53 TARGETS UP | 601 | 369 | All SZGR 2.0 genes in this pathway |
| ACEVEDO LIVER CANCER WITH H3K27ME3 UP | 295 | 149 | All SZGR 2.0 genes in this pathway |
| CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MCV6 LCP WITH H3K4ME3 | 162 | 80 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MEF LCP WITH H3K4ME3 | 128 | 68 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 1HR DN | 222 | 147 | All SZGR 2.0 genes in this pathway |
| JOHNSTONE PARVB TARGETS 2 DN | 336 | 211 | All SZGR 2.0 genes in this pathway |
| LIM MAMMARY STEM CELL DN | 428 | 246 | All SZGR 2.0 genes in this pathway |
| NABA SECRETED FACTORS | 344 | 197 | All SZGR 2.0 genes in this pathway |
| NABA MATRISOME ASSOCIATED | 753 | 411 | All SZGR 2.0 genes in this pathway |
| NABA MATRISOME | 1028 | 559 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-378 | 77 | 83 | 1A | hsa-miR-378 | CUCCUGACUCCAGGUCCUGUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.