SZGR2

Summary ?

GeneID	7402
Symbol	UTRN
Synonyms	DMDL\|DRP\|DRP1
Description	utrophin
Reference	MIM:128240\|HGNC:HGNC:12635\|Ensembl:ENSG00000152818\|HPRD:00547\|Vega:OTTHUMG00000015746
Gene type	protein-coding
Map location	6q24
Pascal p-value	0.282
Fetal beta	-0.172
eGene	Myers' cis & trans
Support	CompositeSet

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DNM:Fromer_2014	Whole Exome Sequencing analysis	This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA.
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0156

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
UTRN	chr6	145073047	C	T	NM_007124	p.2772R>C	missense			Schizophrenia	DNM:Fromer_2014

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs7738467	chr6	145457783	UTRN	7402		0.15		cis

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003779	actin binding	IEA		-
GO:0005509	calcium ion binding	IEA		-
GO:0005515	protein binding	IPI		8576247
GO:0005198	structural molecule activity	IEA		-
GO:0008270	zinc ion binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007517	muscle development	TAS		9288751
GO:0006936	muscle contraction	TAS		9288751
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0045211	postsynaptic membrane	IEA	Synap, Neurotransmitter (GO term level: 5)	-
GO:0045202	synapse	IEA	neuron, Synap, Neurotransmitter, Glial (GO term level: 2)	-
GO:0005856	cytoskeleton	TAS		8977119
GO:0005624	membrane fraction	TAS		1426262
GO:0005737	cytoplasm	IEA		-
GO:0005886	plasma membrane	TAS		8977119
GO:0030054	cell junction	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
BIOCARTA AGR PATHWAY	36	31	All SZGR 2.0 genes in this pathway
THUM SYSTOLIC HEART FAILURE UP	423	283	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER BASAL VS MESENCHYMAL DN	50	36	All SZGR 2.0 genes in this pathway
RODRIGUES DCC TARGETS DN	121	84	All SZGR 2.0 genes in this pathway
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION MONOCYTE DN	54	38	All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS DN	260	143	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS DN	536	332	All SZGR 2.0 genes in this pathway
GOZGIT ESR1 TARGETS DN	781	465	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS DN	508	354	All SZGR 2.0 genes in this pathway
CHIARADONNA NEOPLASTIC TRANSFORMATION CDC25 DN	153	100	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP	1142	669	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP	612	367	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 6 7WK DN	79	54	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL TGFB1 TARGETS UP	169	127	All SZGR 2.0 genes in this pathway
EBAUER TARGETS OF PAX3 FOXO1 FUSION UP	207	128	All SZGR 2.0 genes in this pathway
EBAUER MYOGENIC TARGETS OF PAX3 FOXO1 FUSION	50	26	All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS FETAL LIVER DN	514	319	All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN	584	395	All SZGR 2.0 genes in this pathway
LE EGR2 TARGETS DN	108	84	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL LONG TERM	302	191	All SZGR 2.0 genes in this pathway
LIAN LIPA TARGETS 6M	74	47	All SZGR 2.0 genes in this pathway
CHUANG OXIDATIVE STRESS RESPONSE DN	11	9	All SZGR 2.0 genes in this pathway
LIAN LIPA TARGETS 3M	59	36	All SZGR 2.0 genes in this pathway
GENTILE UV LOW DOSE DN	67	46	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP	953	554	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP	783	442	All SZGR 2.0 genes in this pathway
DURCHDEWALD SKIN CARCINOGENESIS DN	264	168	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 5	482	296	All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3	491	310	All SZGR 2.0 genes in this pathway
ZHENG FOXP3 TARGETS IN T LYMPHOCYTE DN	37	29	All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE UP	578	341	All SZGR 2.0 genes in this pathway
MOLENAAR TARGETS OF CCND1 AND CDK4 UP	67	48	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA UP	207	143	All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS CONFLUENT	567	365	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 6HR DN	91	56	All SZGR 2.0 genes in this pathway
GABRIELY MIR21 TARGETS	289	187	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP B	549	316	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	1600	1607	1A,m8	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-1/206	400	406	m8	hsa-miR-1	UGGAAUGUAAAGAAGUAUGUA
				hsa-miR-206^SZ	UGGAAUGUAAGGAAGUGUGUGG
				hsa-miR-613	AGGAAUGUUCCUUCUUUGCC
miR-142-3p	1863	1870	1A,m8	hsa-miR-142-3p	UGUAGUGUUUCCUACUUUAUGGA
miR-153	223	230	1A,m8	hsa-miR-153	UUGCAUAGUCACAAAAGUGA
miR-381	286	292	1A	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-410	1569	1575	1A	hsa-miR-410	AAUAUAACACAGAUGGCCUGU
miR-448	224	230	1A	hsa-miR-448	UUGCAUAUGUAGGAUGUCCCAU
miR-9	160	166	1A	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: UTRN