Gene Page: SCG2
Summary ?
GeneID | 7857 |
Symbol | SCG2 |
Synonyms | CHGC|EM66|SN|SgII |
Description | secretogranin II |
Reference | MIM:118930|HGNC:HGNC:10575|Ensembl:ENSG00000171951|HPRD:06762|Vega:OTTHUMG00000133166 |
Gene type | protein-coding |
Map location | 2q35-q36 |
Pascal p-value | 0.622 |
Sherlock p-value | 0.9 |
Fetal beta | -2.235 |
Support | NEUROTROPHIN SIGNALING |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00916 | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01016 | |
Expression | Meta-analysis of gene expression | P value: 2.005 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
NLN | 0.87 | 0.93 |
GFPT1 | 0.86 | 0.92 |
HISPPD1 | 0.86 | 0.93 |
PANK3 | 0.86 | 0.91 |
CASK | 0.85 | 0.92 |
PANX1 | 0.85 | 0.92 |
RNF180 | 0.85 | 0.91 |
PRKAR2A | 0.85 | 0.91 |
HSDL1 | 0.85 | 0.91 |
PLCXD2 | 0.84 | 0.92 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.31 | -0.64 | -0.83 |
HLA-F | -0.64 | -0.74 |
FXYD1 | -0.63 | -0.83 |
MT-CO2 | -0.63 | -0.84 |
AF347015.27 | -0.62 | -0.80 |
AF347015.33 | -0.62 | -0.81 |
TSC22D4 | -0.62 | -0.75 |
MT-CYB | -0.61 | -0.81 |
AF347015.8 | -0.61 | -0.83 |
C5orf53 | -0.61 | -0.69 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005125 | cytokine activity | IDA | 14970115 | |
GO:0005509 | calcium ion binding | IEA | - | |
GO:0042056 | chemoattractant activity | IDA | 9473216 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0000165 | MAPKKK cascade | IDA | 14970115 | |
GO:0001525 | angiogenesis | IDA | 14970115 | |
GO:0001937 | negative regulation of endothelial cell proliferation | TAS | 9473216 | |
GO:0001938 | positive regulation of endothelial cell proliferation | IDA | 14970115 | |
GO:0007242 | intracellular signaling cascade | IDA | 9473216 | |
GO:0009306 | protein secretion | TAS | 2745426 | |
GO:0006954 | inflammatory response | TAS | 14970115 | |
GO:0006928 | cell motion | IDA | 9473216 | |
GO:0043066 | negative regulation of apoptosis | IDA | 14970115 | |
GO:0050930 | induction of positive chemotaxis | IDA | 9473216 | |
GO:0048245 | eosinophil chemotaxis | IDA | 9473216 | |
GO:0043542 | endothelial cell migration | TAS | 9473216 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005576 | extracellular region | IEA | - | |
GO:0005615 | extracellular space | IDA | 9473216 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
CORRE MULTIPLE MYELOMA UP | 74 | 45 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER BASAL VS MESENCHYMAL DN | 50 | 36 | All SZGR 2.0 genes in this pathway |
SABATES COLORECTAL ADENOMA DN | 291 | 176 | All SZGR 2.0 genes in this pathway |
KAN RESPONSE TO ARSENIC TRIOXIDE | 123 | 80 | All SZGR 2.0 genes in this pathway |
WEI MYCN TARGETS WITH E BOX | 795 | 478 | All SZGR 2.0 genes in this pathway |
RORIE TARGETS OF EWSR1 FLI1 FUSION DN | 30 | 23 | All SZGR 2.0 genes in this pathway |
IGLESIAS E2F TARGETS UP | 151 | 103 | All SZGR 2.0 genes in this pathway |
WANG SMARCE1 TARGETS DN | 371 | 218 | All SZGR 2.0 genes in this pathway |
KAYO AGING MUSCLE UP | 244 | 165 | All SZGR 2.0 genes in this pathway |
OSADA ASCL1 TARGETS UP | 46 | 30 | All SZGR 2.0 genes in this pathway |
LABBE WNT3A TARGETS DN | 97 | 53 | All SZGR 2.0 genes in this pathway |
HUNSBERGER EXERCISE REGULATED GENES | 31 | 26 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS DN | 366 | 257 | All SZGR 2.0 genes in this pathway |
RUIZ TNC TARGETS UP | 153 | 107 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
HOELZEL NF1 TARGETS UP | 139 | 93 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 3 UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-155 | 406 | 412 | m8 | hsa-miR-155 | UUAAUGCUAAUCGUGAUAGGGG |
miR-374 | 409 | 415 | 1A | hsa-miR-374 | UUAUAAUACAACCUGAUAAGUG |
miR-495 | 358 | 364 | 1A | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
miR-543 | 472 | 478 | 1A | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.