Gene Page: TFEB
Summary ?
| GeneID | 7942 |
| Symbol | TFEB |
| Synonyms | ALPHATFEB|BHLHE35|TCFEB |
| Description | transcription factor EB |
| Reference | MIM:600744|HGNC:HGNC:11753|Ensembl:ENSG00000112561|HPRD:02847|Vega:OTTHUMG00000014684 |
| Gene type | protein-coding |
| Map location | 6p21 |
| Pascal p-value | 0.256 |
| Sherlock p-value | 0.138 |
| Fetal beta | -1.163 |
| DMG | 1 (# studies) |
| eGene | Cerebellar Hemisphere Cerebellum Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
| GSMA_I | Genome scan meta-analysis | Psr: 0.033 | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.04433 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg02286549 | 6 | 41700710 | TFEB | 3.31E-4 | -0.55 | 0.041 | DMG:Wockner_2014 |
| cg02284014 | 6 | 41674099 | TFEB | 3.641E-4 | -0.503 | 0.042 | DMG:Wockner_2014 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| snp_a-1878583 | 0 | TFEB | 7942 | 0.11 | trans | |||
| rs737714 | chr7 | 9187293 | TFEB | 7942 | 0.19 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003700 | transcription factor activity | IEA | - | |
| GO:0003700 | transcription factor activity | NAS | 2115126 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0045893 | positive regulation of transcription, DNA-dependent | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | NAS | 2115126 | |
| GO:0005667 | transcription factor complex | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| MULLIGHAN MLL SIGNATURE 1 UP | 380 | 236 | All SZGR 2.0 genes in this pathway |
| MULLIGHAN MLL SIGNATURE 2 UP | 418 | 263 | All SZGR 2.0 genes in this pathway |
| MYLLYKANGAS AMPLIFICATION HOT SPOT 15 | 13 | 9 | All SZGR 2.0 genes in this pathway |
| WANG HCP PROSTATE CANCER | 111 | 69 | All SZGR 2.0 genes in this pathway |
| RICKMAN METASTASIS DN | 261 | 155 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
| QI PLASMACYTOMA UP | 259 | 185 | All SZGR 2.0 genes in this pathway |
| GRESHOCK CANCER COPY NUMBER UP | 323 | 240 | All SZGR 2.0 genes in this pathway |
| BOHN PRIMARY IMMUNODEFICIENCY SYNDROM DN | 40 | 31 | All SZGR 2.0 genes in this pathway |
| RUTELLA RESPONSE TO CSF2RB AND IL4 DN | 315 | 201 | All SZGR 2.0 genes in this pathway |
| RUTELLA RESPONSE TO HGF UP | 418 | 282 | All SZGR 2.0 genes in this pathway |
| RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 UP | 408 | 276 | All SZGR 2.0 genes in this pathway |
| VALK AML CLUSTER 5 | 33 | 24 | All SZGR 2.0 genes in this pathway |
| ZHAN MULTIPLE MYELOMA PR DN | 44 | 34 | All SZGR 2.0 genes in this pathway |
| SENGUPTA EBNA1 ANTICORRELATED | 173 | 85 | All SZGR 2.0 genes in this pathway |
| GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-124/506 | 594 | 600 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
| hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
| miR-128 | 608 | 614 | m8 | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
| hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
| miR-29 | 494 | 501 | 1A,m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
| hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
| hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
| miR-330 | 613 | 619 | m8 | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA |
| miR-377 | 90 | 97 | 1A,m8 | hsa-miR-377 | AUCACACAAAGGCAACUUUUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.