SZGR2

Summary ?

GeneID	84456
Symbol	L3MBTL3
Synonyms	MBT-1\|MBT1
Description	l(3)mbt-like 3 (Drosophila)
Reference	HGNC:HGNC:23035\|Ensembl:ENSG00000198945\|HPRD:11222\|Vega:OTTHUMG00000015554
Gene type	protein-coding
Map location	6q23
Pascal p-value	0.631
Sherlock p-value	0.704
Fetal beta	1.706
DMG	1 (# studies)

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg15801215	6	130341195	L3MBTL3	5.62E-8	-0.019	1.45E-5	DMG:Jaffe_2016

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003674	molecular_function	ND		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0045449	regulation of transcription	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	NAS		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN	514	330	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS EARLY PROGENITOR	532	309	All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3	491	310	All SZGR 2.0 genes in this pathway
ZHENG FOXP3 TARGETS IN THYMUS UP	196	137	All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE UP	578	341	All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR UP	430	288	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA D UP	89	62	All SZGR 2.0 genes in this pathway
PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 UP	134	85	All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION DN	321	200	All SZGR 2.0 genes in this pathway
FOSTER KDM1A TARGETS UP	266	142	All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM B	517	302	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-138	655	662	1A,m8	hsa-miR-138^brain	AGCUGGUGUUGUGAAUC
miR-17-5p/20/93.mr/106/519.d	1218	1225	1A,m8	hsa-miR-17-5p	CAAAGUGCUUACAGUGCAGGUAGU
				hsa-miR-20a^brain	UAAAGUGCUUAUAGUGCAGGUAG
				hsa-miR-106a	AAAAGUGCUUACAGUGCAGGUAGC
				hsa-miR-106b^SZ	UAAAGUGCUGACAGUGCAGAU
				hsa-miR-20b^SZ	CAAAGUGCUCAUAGUGCAGGUAG
				hsa-miR-519d	CAAAGUGCCUCCCUUUAGAGUGU
miR-183	487	494	1A,m8	hsa-miR-183	UAUGGCACUGGUAGAAUUCACUG
miR-19	618	624	m8	hsa-miR-19a	UGUGCAAAUCUAUGCAAAACUGA
miR-19	618	624	m8	hsa-miR-19b	UGUGCAAAUCCAUGCAAAACUGA
miR-218	57	64	1A,m8	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU
miR-410	400	406	1A	hsa-miR-410	AAUAUAACACAGAUGGCCUGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: L3MBTL3