SZGR2

Summary ?

GeneID	9217
Symbol	VAPB
Synonyms	ALS8\|VAMP-B\|VAP-B
Description	VAMP (vesicle-associated membrane protein)-associated protein B and C
Reference	MIM:605704\|HGNC:HGNC:12649\|Ensembl:ENSG00000124164\|HPRD:09300\|Vega:OTTHUMG00000032840
Gene type	protein-coding
Map location	20q13.33
Pascal p-value	0.362
Sherlock p-value	0.13
Fetal beta	-0.843
DMG	1 (# studies)
eGene	Hippocampus Myers' cis & trans Meta
Support	G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS CompositeSet

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg07628558	20	56964831	VAPB	1.36E-9	-0.021	1.37E-6	DMG:Jaffe_2016

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs12790959	chr11	131620615	VAPB	9217		0.18		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
COPS3	0.92	0.90
EIF3M	0.92	0.92
RBM34	0.92	0.90
RSL24D1	0.92	0.91
PSMD14	0.92	0.88
PSMA2	0.91	0.90
CCT4	0.91	0.91
MMADHC	0.91	0.91
BXDC2	0.91	0.89
PPA1	0.91	0.84

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.26	-0.68	-0.73
AF347015.2	-0.67	-0.72
AF347015.15	-0.66	-0.71
MT-CYB	-0.66	-0.71
AF347015.33	-0.66	-0.71
AF347015.8	-0.65	-0.70
MT-CO2	-0.65	-0.67
FAM38A	-0.64	-0.69
GPT	-0.64	-0.68
SLC6A12	-0.63	-0.69

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005198	structural molecule activity	IEA		-
GO:0042803	protein homodimerization activity	IPI		9920726 \|16227268 \|17540579
GO:0019899	enzyme binding	IPI		17540579
GO:0046982	protein heterodimerization activity	IPI		9920726 \|16227268
GO:0048487	beta-tubulin binding	IDA		17540579
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0019048	virus-host interaction	IDA		16227268
GO:0030968	endoplasmic reticulum unfolded protein response	IMP		16891305
GO:0045070	positive regulation of viral genome replication	IMP		16227268
GO:0044419	interspecies interaction between organisms	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0012505	endomembrane system	IEA		-
GO:0005794	Golgi apparatus	IDA		16227268
GO:0005789	endoplasmic reticulum membrane	IDA		16227268
GO:0005624	membrane fraction	IEA		-
GO:0005783	endoplasmic reticulum	IDA		15372378 \|16891305
GO:0016021	integral to membrane	IEA		-
GO:0005886	plasma membrane	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
REACTOME SPHINGOLIPID DE NOVO BIOSYNTHESIS	31	18	All SZGR 2.0 genes in this pathway
REACTOME PHOSPHOLIPID METABOLISM	198	112	All SZGR 2.0 genes in this pathway
REACTOME SPHINGOLIPID METABOLISM	69	40	All SZGR 2.0 genes in this pathway
REACTOME METABOLISM OF LIPIDS AND LIPOPROTEINS	478	302	All SZGR 2.0 genes in this pathway
WINTER HYPOXIA UP	92	57	All SZGR 2.0 genes in this pathway
PARENT MTOR SIGNALING UP	567	375	All SZGR 2.0 genes in this pathway
CHEMNITZ RESPONSE TO PROSTAGLANDIN E2 DN	391	222	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LIVE UP	485	293	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN	805	505	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 5 6WK DN	137	97	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 6 7WK UP	197	135	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL TGFB1 TARGETS DN	62	44	All SZGR 2.0 genes in this pathway
LUI THYROID CANCER CLUSTER 2	42	31	All SZGR 2.0 genes in this pathway
JAZAG TGFB1 SIGNALING VIA SMAD4 DN	66	38	All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS	988	594	All SZGR 2.0 genes in this pathway
NIKOLSKY BREAST CANCER 20Q12 Q13 AMPLICON	149	76	All SZGR 2.0 genes in this pathway
CHEOK RESPONSE TO MERCAPTOPURINE DN	22	15	All SZGR 2.0 genes in this pathway
KAAB FAILED HEART ATRIUM DN	141	99	All SZGR 2.0 genes in this pathway
RAMASWAMY METASTASIS DN	61	47	All SZGR 2.0 genes in this pathway
JIANG VHL TARGETS	138	91	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 48HR DN	504	323	All SZGR 2.0 genes in this pathway
JIANG HYPOXIA NORMAL	311	205	All SZGR 2.0 genes in this pathway
JIANG HYPOXIA CANCER	83	52	All SZGR 2.0 genes in this pathway
MONNIER POSTRADIATION TUMOR ESCAPE DN	373	196	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS DN	543	317	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS UP	602	364	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS UP	601	369	All SZGR 2.0 genes in this pathway
RIZKI TUMOR INVASIVENESS 3D UP	210	124	All SZGR 2.0 genes in this pathway
FUJII YBX1 TARGETS DN	202	132	All SZGR 2.0 genes in this pathway
ROME INSULIN TARGETS IN MUSCLE UP	442	263	All SZGR 2.0 genes in this pathway
YOSHIOKA LIVER CANCER EARLY RECURRENCE UP	40	23	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 30MIN DN	150	99	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 1HR DN	222	147	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 4HR DN	254	158	All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS UP	682	433	All SZGR 2.0 genes in this pathway
JUBAN TARGETS OF SPI1 AND FLI1 UP	115	73	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-133	639	646	1A,m8	hsa-miR-133a	UUGGUCCCCUUCAACCAGCUGU
miR-133	639	646	1A,m8	hsa-miR-133b	UUGGUCCCCUUCAACCAGCUA
miR-143	102	108	1A	hsa-miR-143^brain	UGAGAUGAAGCACUGUAGCUCA
miR-143	102	108	1A	hsa-miR-143^brain	UGAGAUGAAGCACUGUAGCUCA
miR-183	1236	1242	1A	hsa-miR-183	UAUGGCACUGGUAGAAUUCACUG
miR-221/222	1269	1276	1A,m8	hsa-miR-221^brain	AGCUACAUUGUCUGCUGGGUUUC
miR-221/222	1269	1276	1A,m8	hsa-miR-222^brain	AGCUACAUCUGGCUACUGGGUCUC
miR-31	113	119	m8	hsa-miR-31	AGGCAAGAUGCUGGCAUAGCUG
miR-376c	1267	1273	1A	hsa-miR-376c	AACAUAGAGGAAAUUCCACG
miR-485-3p	92	98	m8	hsa-miR-485-3p	GUCAUACACGGCUCUCCUCUCU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: VAPB