SZGR2

Summary ?

GeneID	9463
Symbol	PICK1
Synonyms	PICK\|PRKCABP
Description	protein interacting with PRKCA 1
Reference	MIM:605926\|HGNC:HGNC:9394\|Ensembl:ENSG00000100151\|HPRD:16176\|Vega:OTTHUMG00000151159
Gene type	protein-coding
Map location	22q13.1
Pascal p-value	0.318
Sherlock p-value	0.589
Fetal beta	-0.319
eGene	Caudate basal ganglia Hippocampus Putamen basal ganglia Myers' cis & trans Meta
Support	PROTEIN CLUSTERING G2Cdb.humanPSD G2Cdb.humanPSP Potential synaptic genes

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Association	A combined odds ratio method (Sun et al. 2008), association studies	2	Link to SZGene
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 3
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 2.7105

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs6596223	chr5	134774309	PICK1	9463		0.14		trans
rs11912649	22	38415542	PICK1	ENSG00000100151.11	2.422E-6	0.02	-36776	gtex_brain_putamen_basal
rs1883471	22	38417510	PICK1	ENSG00000100151.11	1.929E-6	0.02	-34808	gtex_brain_putamen_basal
rs5995530	22	38419738	PICK1	ENSG00000100151.11	2.622E-6	0.02	-32580	gtex_brain_putamen_basal
rs713991	22	38426043	PICK1	ENSG00000100151.11	1.922E-6	0.02	-26275	gtex_brain_putamen_basal
rs3026670	22	38426774	PICK1	ENSG00000100151.11	1.64E-6	0.02	-25544	gtex_brain_putamen_basal
rs10427673	22	38427551	PICK1	ENSG00000100151.11	1.891E-6	0.02	-24767	gtex_brain_putamen_basal
rs8142174	22	38427963	PICK1	ENSG00000100151.11	1.561E-6	0.02	-24355	gtex_brain_putamen_basal
rs6519095	22	38431917	PICK1	ENSG00000100151.11	1.551E-6	0.02	-20401	gtex_brain_putamen_basal
rs12157609	22	38432277	PICK1	ENSG00000100151.11	1.242E-6	0.02	-20041	gtex_brain_putamen_basal
rs4821730	22	38441587	PICK1	ENSG00000100151.11	8.873E-7	0.02	-10731	gtex_brain_putamen_basal
rs4821731	22	38445214	PICK1	ENSG00000100151.11	9.399E-7	0.02	-7104	gtex_brain_putamen_basal
rs5756890	22	38445400	PICK1	ENSG00000100151.11	1.083E-6	0.02	-6918	gtex_brain_putamen_basal
rs760973	22	38447266	PICK1	ENSG00000100151.11	9.684E-7	0.02	-5052	gtex_brain_putamen_basal
rs4384887	22	38447365	PICK1	ENSG00000100151.11	1.12E-6	0.02	-4953	gtex_brain_putamen_basal
rs742395	22	38447444	PICK1	ENSG00000100151.11	9.21E-7	0.02	-4874	gtex_brain_putamen_basal
rs2413493	22	38448295	PICK1	ENSG00000100151.11	1.424E-6	0.02	-4023	gtex_brain_putamen_basal
rs4821733	22	38449394	PICK1	ENSG00000100151.11	2.354E-6	0.02	-2924	gtex_brain_putamen_basal
.	22	38449820	PICK1	ENSG00000100151.11	2.179E-6	0.02	-2498	gtex_brain_putamen_basal
rs5756894	22	38450136	PICK1	ENSG00000100151.11	2.332E-6	0.02	-2182	gtex_brain_putamen_basal
rs2018980	22	38450620	PICK1	ENSG00000100151.11	1.693E-6	0.02	-1698	gtex_brain_putamen_basal
rs742396	22	38452254	PICK1	ENSG00000100151.11	9.904E-7	0.02	-64	gtex_brain_putamen_basal
rs738442	22	38457329	PICK1	ENSG00000100151.11	2.578E-6	0.02	5011	gtex_brain_putamen_basal
rs738443	22	38458681	PICK1	ENSG00000100151.11	9.904E-7	0.02	6363	gtex_brain_putamen_basal
rs4821735	22	38458969	PICK1	ENSG00000100151.11	9.904E-7	0.02	6651	gtex_brain_putamen_basal
rs6000991	22	38460484	PICK1	ENSG00000100151.11	9.904E-7	0.02	8166	gtex_brain_putamen_basal
rs2076369	22	38463652	PICK1	ENSG00000100151.11	9.904E-7	0.02	11334	gtex_brain_putamen_basal
rs2076370	22	38463968	PICK1	ENSG00000100151.11	9.904E-7	0.02	11650	gtex_brain_putamen_basal

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
CPNE6	0.60	0.68
NELF	0.58	0.65
PRKCG	0.57	0.68
CD6	0.57	0.57
CNGB1	0.57	0.60
FIBCD1	0.56	0.50
SUSD4	0.56	0.61
SYT17	0.55	0.62
GALNTL4	0.54	0.53
TTC7B	0.54	0.66

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
KIAA1949	-0.27	-0.22
RBMX2	-0.26	-0.39
ZNF193	-0.25	-0.18
FAM167B	-0.25	-0.39
TUBB2B	-0.25	-0.26
SH2B2	-0.25	-0.34
AP000349.1	-0.25	-0.27
SPATA9	-0.25	-0.26
TMSB15A	-0.25	-0.28
ZNF300	-0.25	-0.13

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005102	receptor binding	ISS	Neurotransmitter (GO term level: 4)	-
GO:0005080	protein kinase C binding	ISS		-
GO:0008022	protein C-terminus binding	IPI		11343649
GO:0016887	ATPase activity	ISS		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0045161	neuronal ion channel clustering	TAS	neuron (GO term level: 11)	11343649
GO:0007205	activation of protein kinase C activity	IDA		10623590
GO:0006468	protein amino acid phosphorylation	ISS		-
GO:0006605	protein targeting	IEA		-
GO:0006890	retrograde vesicle-mediated transport, Golgi to ER	NAS		10623590
GO:0015844	monoamine transport	IDA		11343649
GO:0043046	DNA methylation during gametogenesis	TAS		12138111
GO:0043113	receptor clustering	ISS		-
GO:0043045	DNA methylation during embryonic development	NAS		12138111
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0042734	presynaptic membrane	IDA	neuron, axon, Synap (GO term level: 5)	11343649
GO:0045202	synapse	ISS	neuron, Synap, Neurotransmitter, Glial (GO term level: 2)	-
GO:0005794	Golgi apparatus	ISS		-
GO:0005737	cytoplasm	IDA		11343649
GO:0005739	mitochondrion	IEA		-
GO:0005886	plasma membrane	IDA		11343649
GO:0048471	perinuclear region of cytoplasm	ISS		-
GO:0030054	cell junction	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ACCN1	ACCN \| ASIC2 \| ASIC2a \| BNC1 \| BNaC1 \| MDEG \| hBNaC1	amiloride-sensitive cation channel 1, neuronal	PICK1 interacts with BNC1a.	BIND	11802773
ACCN1	ACCN \| ASIC2 \| ASIC2a \| BNC1 \| BNaC1 \| MDEG \| hBNaC1	amiloride-sensitive cation channel 1, neuronal	-	HPRD	11739374
ACCN1	ACCN \| ASIC2 \| ASIC2a \| BNC1 \| BNaC1 \| MDEG \| hBNaC1	amiloride-sensitive cation channel 1, neuronal	PICK1 interacts with BNC1b.	BIND	11802773
ACCN2	ASIC \| ASIC1 \| ASIC1A \| BNaC2 \| hBNaC2	amiloride-sensitive cation channel 2, neuronal	PICK1 interacts with ASIC.	BIND	11802773
ACCN2	ASIC \| ASIC1 \| ASIC1A \| BNaC2 \| hBNaC2	amiloride-sensitive cation channel 2, neuronal	-	HPRD,BioGRID	11739374 \|11802773 \|12578970
BNC1	BNC \| BSN1 \| HsT19447	basonuclin 1	Affinity Capture-Western Two-hybrid	BioGRID	11802773
BTG2	MGC126063 \| MGC126064 \| PC3 \| TIS21	BTG family, member 2	-	HPRD	11237868
EFNB1	CFND \| CFNS \| EFL3 \| EPLG2 \| Elk-L \| LERK2 \| MGC8782	ephrin-B1	-	HPRD,BioGRID	9883737
ERBB2	CD340 \| HER-2 \| HER-2/neu \| HER2 \| NEU \| NGL \| TKR1	v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)	-	HPRD,BioGRID	11278603
ERBB2IP	ERBIN \| LAP2	erbb2 interacting protein	Two-hybrid	BioGRID	11278603
GRIA1	GLUH1 \| GLUR1 \| GLURA \| HBGR1 \| MGC133252	glutamate receptor, ionotropic, AMPA 1	-	HPRD,BioGRID	11891216
GRIA2	GLUR2 \| GLURB \| GluR-K2 \| HBGR2	glutamate receptor, ionotropic, AMPA 2	Reconstituted Complex Two-hybrid	BioGRID	11891216
GRIA3	GLUR-C \| GLUR-K3 \| GLUR3 \| GLURC \| MRX94	glutamate receptor, ionotrophic, AMPA 3	Reconstituted Complex Two-hybrid	BioGRID	11891216
GRIA4	GLUR4 \| GLUR4C \| GLURD	glutamate receptor, ionotrophic, AMPA 4	Reconstituted Complex Two-hybrid	BioGRID	11891216
GRIK1	EAA3 \| EEA3 \| GLR5 \| GLUR5	glutamate receptor, ionotropic, kainate 1	-	HPRD	11891216
GRIK1	EAA3 \| EEA3 \| GLR5 \| GLUR5	glutamate receptor, ionotropic, kainate 1	-	HPRD,BioGRID	12597860
GRIK2	EAA4 \| GLR6 \| GLUK6 \| GLUR6 \| MGC74427 \| MRT6	glutamate receptor, ionotropic, kainate 2	-	HPRD,BioGRID	12597860
GRIK3	EAA5 \| GLR7 \| GLUR7 \| GluR7a	glutamate receptor, ionotropic, kainate 3	Reconstituted Complex Two-hybrid	BioGRID	11891216
GRM3	GLUR3 \| GPRC1C \| MGLUR3 \| mGlu3	glutamate receptor, metabotropic 3	Reconstituted Complex Two-hybrid	BioGRID	11891216
GRM7	FLJ40498 \| GLUR7 \| GPRC1G \| MGLUR7 \| mGlu7	glutamate receptor, metabotropic 7	PICK1 interacts with mGluR7b. This interaction was modeled on a demonstrated interaction between PICK1 from an unspecified species and human mGluR7b.	BIND	11891216
GRM7	FLJ40498 \| GLUR7 \| GPRC1G \| MGLUR7 \| mGlu7	glutamate receptor, metabotropic 7	Affinity Capture-Western Biochemical Activity Reconstituted Complex Two-hybrid	BioGRID	11007882
LRP2BP	DKFZp761O0113 \| FLJ44965	LRP2 binding protein	-	HPRD	12508107
PICK1	MGC15204 \| PICK \| PRKCABP	protein interacting with PRKCA 1	PICK1 interacts with another PICK1.	BIND	11802773
PRKCA	AAG6 \| MGC129900 \| MGC129901 \| PKC-alpha \| PKCA \| PRKACA	protein kinase C, alpha	Affinity Capture-Western	BioGRID	11007882
PRLHR	GPR10 \| GR3 \| MGC126539 \| MGC126541 \| PrRPR	prolactin releasing hormone receptor	Affinity Capture-Western	BioGRID	11641419
SLC6A3	DAT \| DAT1	solute carrier family 6 (neurotransmitter transporter, dopamine), member 3	-	HPRD,BioGRID	11343649

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
REACTOME TRANSMISSION ACROSS CHEMICAL SYNAPSES	186	155	All SZGR 2.0 genes in this pathway
REACTOME NEURONAL SYSTEM	279	221	All SZGR 2.0 genes in this pathway
REACTOME NEUROTRANSMITTER RECEPTOR BINDING AND DOWNSTREAM TRANSMISSION IN THE POSTSYNAPTIC CELL	137	110	All SZGR 2.0 genes in this pathway
REACTOME TRAFFICKING OF AMPA RECEPTORS	28	23	All SZGR 2.0 genes in this pathway
REACTOME TRAFFICKING OF GLUR2 CONTAINING AMPA RECEPTORS	16	11	All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER ZNF217 AMPLIFIED DN	335	193	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION UP	552	347	All SZGR 2.0 genes in this pathway
PENG LEUCINE DEPRIVATION UP	142	93	All SZGR 2.0 genes in this pathway
PENG GLUCOSE DEPRIVATION DN	169	112	All SZGR 2.0 genes in this pathway
PENG GLUTAMINE DEPRIVATION DN	337	230	All SZGR 2.0 genes in this pathway
MAGRANGEAS MULTIPLE MYELOMA IGLL VS IGLK UP	42	24	All SZGR 2.0 genes in this pathway
MOREAUX MULTIPLE MYELOMA BY TACI UP	412	249	All SZGR 2.0 genes in this pathway
MOREAUX B LYMPHOCYTE MATURATION BY TACI UP	92	58	All SZGR 2.0 genes in this pathway
ZAMORA NOS2 TARGETS UP	69	41	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
MCCABE BOUND BY HOXC6	469	239	All SZGR 2.0 genes in this pathway
MCCABE HOXC6 TARGETS CANCER UP	31	23	All SZGR 2.0 genes in this pathway
FIRESTEIN PROLIFERATION	175	125	All SZGR 2.0 genes in this pathway
FONTAINE FOLLICULAR THYROID ADENOMA DN	68	45	All SZGR 2.0 genes in this pathway
FONTAINE PAPILLARY THYROID CARCINOMA DN	80	53	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE LATE	1137	655	All SZGR 2.0 genes in this pathway
KASLER HDAC7 TARGETS 1 UP	194	133	All SZGR 2.0 genes in this pathway
DELACROIX RARG BOUND MEF	367	231	All SZGR 2.0 genes in this pathway
DELACROIX RAR BOUND ES	462	273	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-214	96	102	m8	hsa-miR-214^brain	ACAGCAGGCACAGACAGGCAG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: PICK1