Gene Page: ATG5
Summary ?
| GeneID | 9474 |
| Symbol | ATG5 |
| Synonyms | APG5|APG5-LIKE|APG5L|ASP|hAPG5 |
| Description | autophagy related 5 |
| Reference | MIM:604261|HGNC:HGNC:589|Ensembl:ENSG00000057663|HPRD:16051|Vega:OTTHUMG00000016193 |
| Gene type | protein-coding |
| Map location | 6q21 |
| Pascal p-value | 0.319 |
| Sherlock p-value | 0.607 |
| Fetal beta | -0.676 |
| DMG | 1 (# studies) |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Expression | Meta-analysis of gene expression | P value: 1.799 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg10566763 | 6 | 106773518 | ATG5 | 4.34E-5 | -0.248 | 0.021 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| TUBB | 0.95 | 0.72 |
| MARCKSL1 | 0.95 | 0.83 |
| HN1 | 0.94 | 0.73 |
| PAFAH1B3 | 0.94 | 0.81 |
| C6orf134 | 0.93 | 0.71 |
| IGFBP2 | 0.93 | 0.80 |
| EIF4A1 | 0.93 | 0.73 |
| TUBB2B | 0.93 | 0.88 |
| TUBB3 | 0.93 | 0.71 |
| DBN1 | 0.93 | 0.71 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| FBXO2 | -0.70 | -0.68 |
| C5orf53 | -0.69 | -0.67 |
| HLA-F | -0.68 | -0.63 |
| CCNI2 | -0.67 | -0.73 |
| AF347015.27 | -0.66 | -0.72 |
| LDHD | -0.65 | -0.61 |
| AIFM3 | -0.65 | -0.57 |
| ALDOC | -0.65 | -0.59 |
| GBP2 | -0.64 | -0.73 |
| RGS5 | -0.64 | -0.69 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IPI | 9852036 |11096062 | |
| GO:0005515 | protein binding | ISS | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0000045 | autophagic vacuole formation | ISS | - | |
| GO:0006915 | apoptosis | IEA | - | |
| GO:0006914 | autophagy | IEA | - | |
| GO:0006914 | autophagy | ISS | - | |
| GO:0043687 | post-translational protein modification | ISS | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005737 | cytoplasm | IEA | - | |
| GO:0005737 | cytoplasm | ISS | - | |
| GO:0005776 | autophagic vacuole | IDA | 15292400 | |
| GO:0043231 | intracellular membrane-bounded organelle | ISS | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG REGULATION OF AUTOPHAGY | 35 | 30 | All SZGR 2.0 genes in this pathway |
| KEGG RIG I LIKE RECEPTOR SIGNALING PATHWAY | 71 | 51 | All SZGR 2.0 genes in this pathway |
| REACTOME NEGATIVE REGULATORS OF RIG I MDA5 SIGNALING | 31 | 19 | All SZGR 2.0 genes in this pathway |
| REACTOME RIG I MDA5 MEDIATED INDUCTION OF IFN ALPHA BETA PATHWAYS | 73 | 57 | All SZGR 2.0 genes in this pathway |
| REACTOME INNATE IMMUNE SYSTEM | 279 | 178 | All SZGR 2.0 genes in this pathway |
| REACTOME IMMUNE SYSTEM | 933 | 616 | All SZGR 2.0 genes in this pathway |
| GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN | 493 | 298 | All SZGR 2.0 genes in this pathway |
| PUIFFE INVASION INHIBITED BY ASCITES DN | 145 | 91 | All SZGR 2.0 genes in this pathway |
| OSMAN BLADDER CANCER UP | 404 | 246 | All SZGR 2.0 genes in this pathway |
| KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA ANAPLASTIC UP | 722 | 443 | All SZGR 2.0 genes in this pathway |
| LINDGREN BLADDER CANCER CLUSTER 3 UP | 329 | 196 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
| FARMER BREAST CANCER BASAL VS LULMINAL | 330 | 215 | All SZGR 2.0 genes in this pathway |
| SHETH LIVER CANCER VS TXNIP LOSS PAM4 | 261 | 153 | All SZGR 2.0 genes in this pathway |
| SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN | 584 | 395 | All SZGR 2.0 genes in this pathway |
| REN ALVEOLAR RHABDOMYOSARCOMA DN | 408 | 274 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 14HR DN | 298 | 200 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 48HR DN | 504 | 323 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RESPONSE TO TRABECTEDIN DN | 271 | 175 | All SZGR 2.0 genes in this pathway |
| AGUIRRE PANCREATIC CANCER COPY NUMBER DN | 238 | 145 | All SZGR 2.0 genes in this pathway |
| SHEDDEN LUNG CANCER POOR SURVIVAL A6 | 456 | 285 | All SZGR 2.0 genes in this pathway |
| WENDT COHESIN TARGETS UP | 33 | 19 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 30MIN DN | 150 | 99 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 4HR DN | 254 | 158 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
| MIZUSHIMA AUTOPHAGOSOME FORMATION | 19 | 15 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-153 | 546 | 552 | 1A | hsa-miR-153 | UUGCAUAGUCACAAAAGUGA |
| miR-181 | 1271 | 1277 | m8 | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
| hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
| hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
| hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
| miR-299-5p | 492 | 498 | m8 | hsa-miR-299-5p | UGGUUUACCGUCCCACAUACAU |
| miR-30-5p | 525 | 532 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
| hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
| hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
| hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
| hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
| miR-448 | 546 | 552 | 1A | hsa-miR-448 | UUGCAUAUGUAGGAUGUCCCAU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.