Gene Page: SV2A
Summary ?
GeneID | 9900 |
Symbol | SV2A |
Synonyms | SV2 |
Description | synaptic vesicle glycoprotein 2A |
Reference | MIM:185860|HGNC:HGNC:20566|Ensembl:ENSG00000159164|HPRD:08922|Vega:OTTHUMG00000012209 |
Gene type | protein-coding |
Map location | 1q21.2 |
Sherlock p-value | 0.983 |
Fetal beta | -1.32 |
Support | EXOCYTOSIS G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_I | Genome scan meta-analysis | Psr: 0.0235 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00814 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
FAM83G | 0.92 | 0.36 |
SLC5A10 | 0.90 | 0.37 |
ZNF521 | 0.82 | 0.40 |
IL28RA | 0.81 | 0.35 |
EPHA1 | 0.80 | 0.26 |
ATBF1 | 0.80 | 0.40 |
HLA-DPB2 | 0.80 | 0.42 |
MADCAM1 | 0.80 | 0.24 |
FOXP2 | 0.79 | 0.18 |
GJD2 | 0.79 | 0.25 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
GTDC1 | -0.27 | -0.17 |
SLC26A4 | -0.26 | -0.22 |
MRGPRF | -0.25 | -0.14 |
PPP2R5A | -0.25 | -0.15 |
MGLL | -0.25 | -0.11 |
IL34 | -0.24 | -0.16 |
PTGDS | -0.24 | -0.15 |
TINAGL1 | -0.24 | -0.12 |
TESK2 | -0.24 | -0.18 |
PC | -0.24 | -0.01 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005215 | transporter activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006836 | neurotransmitter transport | IEA | neuron, Neurotransmitter (GO term level: 5) | - |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0045202 | synapse | IEA | neuron, Synap, Neurotransmitter, Glial (GO term level: 2) | - |
GO:0005737 | cytoplasm | IDA | 18029348 | |
GO:0005783 | endoplasmic reticulum | IDA | 11256614 | |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - | |
GO:0030054 | cell junction | IEA | - | |
GO:0031410 | cytoplasmic vesicle | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG ECM RECEPTOR INTERACTION | 84 | 53 | All SZGR 2.0 genes in this pathway |
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN | 663 | 425 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN | 460 | 312 | All SZGR 2.0 genes in this pathway |
JAATINEN HEMATOPOIETIC STEM CELL UP | 316 | 190 | All SZGR 2.0 genes in this pathway |
DELYS THYROID CANCER UP | 443 | 294 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 2 UP | 256 | 159 | All SZGR 2.0 genes in this pathway |
MATSUDA NATURAL KILLER DIFFERENTIATION | 475 | 313 | All SZGR 2.0 genes in this pathway |
LI WILMS TUMOR VS FETAL KIDNEY 1 DN | 163 | 115 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS STEM CELL | 254 | 164 | All SZGR 2.0 genes in this pathway |
DEBIASI APOPTOSIS BY REOVIRUS INFECTION DN | 287 | 208 | All SZGR 2.0 genes in this pathway |
LEE AGING MUSCLE UP | 45 | 33 | All SZGR 2.0 genes in this pathway |
CHEN HOXA5 TARGETS 9HR DN | 41 | 17 | All SZGR 2.0 genes in this pathway |
NAKAYAMA SOFT TISSUE TUMORS PCA2 UP | 87 | 50 | All SZGR 2.0 genes in this pathway |
MIKKELSEN ES ICP WITH H3K4ME3 | 718 | 401 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
GUILLAUMOND KLF10 TARGETS UP | 51 | 39 | All SZGR 2.0 genes in this pathway |
PHONG TNF RESPONSE VIA P38 COMPLETE | 227 | 151 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-128 | 33 | 40 | 1A,m8 | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
miR-133 | 424 | 430 | 1A | hsa-miR-133a | UUGGUCCCCUUCAACCAGCUGU |
hsa-miR-133b | UUGGUCCCCUUCAACCAGCUA | ||||
miR-137 | 501 | 508 | 1A,m8 | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
miR-138 | 1037 | 1043 | 1A | hsa-miR-138brain | AGCUGGUGUUGUGAAUC |
miR-19 | 245 | 252 | 1A,m8 | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
miR-218 | 1051 | 1058 | 1A,m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
miR-22 | 620 | 626 | m8 | hsa-miR-22brain | AAGCUGCCAGUUGAAGAACUGU |
miR-27 | 34 | 40 | m8 | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
miR-421 | 617 | 623 | 1A | hsa-miR-421 | GGCCUCAUUAAAUGUUUGUUG |
miR-485-5p | 1159 | 1165 | 1A | hsa-miR-485-5p | AGAGGCUGGCCGUGAUGAAUUC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.