Gene Page: CNP

Summary
GeneID  1267
Symbol  CNP
Synonyms  CNP1
Description  2',3'-cyclic nucleotide 3' phosphodiesterase
See related  HGNC:2158|MIM:123830|Ensembl:ENSG00000173786|HPRD:00448|
Locus tag  -
Gene type  protein-coding
Map location  17q21
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
AssociationA combined odds ratio method (Sun et al. 2008), association studies1Link to SZGene
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:00041132',3'-cyclic-nucleotide 3'-phosphodiesterase activityTAS8392017 
GO:0016787hydrolase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007409axonogenesisIEAneuron, axon, neurite (GO term level: 12)-
GO:0007268synaptic transmissionTASneuron, Synap, Neurotransmitter (GO term level: 6)1322358 
GO:0016070RNA metabolic processIEA-
GO:0008344adult locomotory behaviorIEA-
GO:0009214cyclic nucleotide catabolic processIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005615extracellular spaceIDA12379507 
GO:0005622intracellularIEA-
GO:0005624membrane fractionIEA-
GO:0005737cytoplasmIDA12379507 
GO:0016020membraneIEA-
GO:0042470melanosomeIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
TUBA1AB-ALPHA-1 | FLJ25113 | LIS3 | TUBA3tubulin, alpha 1a-HPRD11842207 
 
Pathway annotation
Pathway namePathway size# SZGR genes in pathwayInfo
GAUSSMANN_MLL_AF4_FUSION_TARGETS_F_UP 185119All SZGR genes in this pathway
SCHLOSSER_SERUM_RESPONSE_DN 712443All SZGR genes in this pathway
DACOSTA_UV_RESPONSE_VIA_ERCC3_UP 309199All SZGR genes in this pathway
TONG_INTERACT_WITH_PTTG1 5732All SZGR genes in this pathway
LEE_TARGETS_OF_PTCH1_AND_SUFU_DN 8369All SZGR genes in this pathway
ASTON_MAJOR_DEPRESSIVE_DISORDER_DN 160110All SZGR genes in this pathway
KAYO_AGING_MUSCLE_UP 244165All SZGR genes in this pathway
LEE_AGING_CEREBELLUM_DN 8666All SZGR genes in this pathway
BLALOCK_ALZHEIMERS_DISEASE_UP 16911088All SZGR genes in this pathway
BROWNE_HCMV_INFECTION_6HR_UP 7148All SZGR genes in this pathway
DACOSTA_UV_RESPONSE_VIA_ERCC3_COMMON_UP 7747All SZGR genes in this pathway
LEIN_OLIGODENDROCYTE_MARKERS 7453All SZGR genes in this pathway
WEST_ADRENOCORTICAL_TUMOR_DN 546362All SZGR genes in this pathway
QI_PLASMACYTOMA_UP 259185All SZGR genes in this pathway
FIRESTEIN_PROLIFERATION 175125All SZGR genes in this pathway
ROME_INSULIN_TARGETS_IN_MUSCLE_DN 204114All SZGR genes in this pathway
BROWNE_HCMV_INFECTION_1HR_DN 222147All SZGR genes in this pathway
PILON_KLF1_TARGETS_DN 19721213All SZGR genes in this pathway
LEE_BMP2_TARGETS_UP 745475All SZGR genes in this pathway
GOBERT_OLIGODENDROCYTE_DIFFERENTIATION_DN 1080713All SZGR genes in this pathway
PECE_MAMMARY_STEM_CELL_UP 14675All SZGR genes in this pathway
LIM_MAMMARY_STEM_CELL_UP 489314All SZGR genes in this pathway
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-141/200a14031409m8hsa-miR-141UAACACUGUCUGGUAAAGAUGG
hsa-miR-200aUAACACUGUCUGGUAACGAUGU
miR-338373837451A,m8hsa-miR-338brainUCCAGCAUCAGUGAUUUUGUUGA
miR-3782242301Ahsa-miR-378CUCCUGACUCCAGGUCCUGUGU
miR-544142514311Ahsa-miR-544AUUCUGCAUUUUUAGCAAGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.