|
GeneID |
4524
|
Symbol |
MTHFR
|
Synonyms |
-
|
Description |
5,10-methylenetetrahydrofolate reductase (NADPH) |
See related |
HGNC:7436|MIM:607093|Ensembl:ENSG00000177000|HPRD:06158| |
Locus tag |
- |
Gene type |
protein-coding |
Map location |
1p36.3 |
|
|
|
Gene set name |
Method of gene set |
Evidence |
Info |
Association | A combined odds ratio method (Sun et al. 2008), association studies | 3 | Link to SZGene | Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia] | Click to show detail | GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 3 | | Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 31 | |
|
|
General Gene Expression (microarray) ? |
|
|
|
Gene Expression in Brain Regions (new) |
|
|
Top co-expressed genes in Brain Regions (new) |
|
Gene | Pearson's Correlation | Spearman's Correlation | | |
Top 10 positively co-expressed genes |
Top 10 negatively co-expressed genes | |
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|
GO:0004489 | methylenetetrahydrofolate reductase (NADPH) activity | EXP | glutamate (GO term level: 6) | 7726158 |
GO:0004489 | methylenetetrahydrofolate reductase (NADPH) activity | IEA | glutamate (GO term level: 6) | - |
GO:0004489 | methylenetetrahydrofolate reductase (NADPH) activity | TAS | glutamate (GO term level: 6) | 7647779 |
GO:0005515 | protein binding | IPI | | 15231747 |
GO:0016491 | oxidoreductase activity | IEA | | - |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
---|
GO:0009086 | methionine biosynthetic process | IEA | | - |
GO:0006520 | amino acid metabolic process | TAS | | 7647779 |
GO:0008015 | blood circulation | TAS | | 7647779 |
GO:0055114 | oxidation reduction | IEA | | - |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
---|
GO:0005829 | cytosol | EXP | | 7726158 |
|
|
|
|
|
|
|
miR-22 | 132 | 139 | 1A,m8 | hsa-miR-22brain | AAGCUGCCAGUUGAAGAACUGU | miR-24 | 1957 | 1964 | 1A,m8 | hsa-miR-24SZ | UGGCUCAGUUCAGCAGGAACAG |
|
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.
|