Gene Page: NAT5

Summary
GeneID  51126
Symbol  NAT5
Synonyms  NAT3|dJ1002M8.1
Description  N-acetyltransferase 5 (GCN5-related, putative)
See related  HGNC:15908|MIM:610833|Ensembl:ENSG00000173418|HPRD:07136|
Locus tag  RP5-1002M8.3
Gene type  protein-coding
Map location  20p11.23
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.046 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0016740transferase activityIEA-
GO:0008415acyltransferase activityIEA-
GO:0008080N-acetyltransferase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0008152metabolic processIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005622intracellularIDA11256614 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
CYTH1B2-1 | CYTOHESIN-1 | D17S811E | FLJ34050 | FLJ41900 | PSCD1 | SEC7cytohesin 1-HPRD10748148 
 
Pathway annotation
Pathway namePathway size# SZGR genes in pathwayInfo
WANG_LMO4_TARGETS_DN 352225All SZGR genes in this pathway
MARTORIATI_MDM4_TARGETS_FETAL_LIVER_UP 227137All SZGR genes in this pathway
NUYTTEN_EZH2_TARGETS_DN 1024594All SZGR genes in this pathway
GEORGES_TARGETS_OF_MIR192_AND_MIR215 893528All SZGR genes in this pathway
ROZANOV_MMP14_TARGETS_UP 266171All SZGR genes in this pathway
NOUZOVA_TRETINOIN_AND_H4_ACETYLATION 14385All SZGR genes in this pathway
KRIGE_RESPONSE_TO_TOSEDOSTAT_6HR_DN 911527All SZGR genes in this pathway
KRIGE_RESPONSE_TO_TOSEDOSTAT_24HR_DN 1011592All SZGR genes in this pathway
YOSHIMURA_MAPK8_TARGETS_DN 366257All SZGR genes in this pathway
PILON_KLF1_TARGETS_DN 19721213All SZGR genes in this pathway
LEE_BMP2_TARGETS_DN 882538All SZGR genes in this pathway
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-103/1073343401Ahsa-miR-103brainAGCAGCAUUGUACAGGGCUAUGA
hsa-miR-107brainAGCAGCAUUGUACAGGGCUAUCA
miR-222202271A,m8hsa-miR-22brainAAGCUGCCAGUUGAAGAACUGU
miR-3203803861Ahsa-miR-320AAAAGCUGGGUUGAGAGGGCGAA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.