|
GeneID |
55915
|
Symbol |
LANCL2
|
Synonyms |
GPR69B|MGC87139|TASP
|
Description |
LanC lantibiotic synthetase component C-like 2 (bacterial) |
See related |
HGNC:6509|Ensembl:ENSG00000132434|HPRD:13956| |
Locus tag |
- |
Gene type |
protein-coding |
Map location |
7q31.1-q31.33 |
|
|
|
Gene set name |
Method of gene set |
Evidence |
Info |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: [schizophrenias, schizophrenic, schizophrenia] | Click to show detail |
|
|
General Gene Expression (microarray) ? |
|
|
|
Gene Expression in Brain Regions (new) |
|
|
Top co-expressed genes in Brain Regions (new) |
|
Gene | Pearson's Correlation | Spearman's Correlation | | |
Top 10 positively co-expressed genes |
TMEM132B | 0.69 | 0.75 | | |
BCL2L13 | 0.68 | 0.68 | | |
ARNT2 | 0.68 | 0.72 | | |
SENP2 | 0.67 | 0.70 | | |
RGL1 | 0.67 | 0.69 | | |
COL5A2 | 0.67 | 0.76 | | |
SCRN1 | 0.66 | 0.65 | | |
TBC1D5 | 0.66 | 0.68 | | |
IPO8 | 0.65 | 0.63 | | |
DPY19L1 | 0.65 | 0.71 | | |
Top 10 negatively co-expressed genes | AF347015.21 | -0.51 | -0.38 | | |
APOC1 | -0.45 | -0.31 | | |
C1orf54 | -0.42 | -0.37 | | |
MT-CO2 | -0.41 | -0.34 | | |
AF347015.18 | -0.40 | -0.30 | | |
AL050337.1 | -0.40 | -0.33 | | |
IL32 | -0.40 | -0.30 | | |
AF347015.8 | -0.39 | -0.30 | | |
FAM159B | -0.38 | -0.40 | | |
AC098691.2 | -0.38 | -0.32 | | |
|
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|
GO:0003824 | catalytic activity | IEA | | - |
GO:0005524 | ATP binding | NAS | | 11762191 |
GO:0005525 | GTP binding | NAS | | 11762191 |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
---|
GO:0016481 | negative regulation of transcription | IDA | | 12566319 |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
---|
GO:0005829 | cytosol | IDA | | 12566319 |
GO:0005634 | nucleus | IDA | | 12566319 |
GO:0005737 | cytoplasm | IEA | | - |
GO:0005886 | plasma membrane | IDA | | 12566319 |
|
|
|
|
miR-494 | 228 | 234 | m8 | hsa-miR-494brain | UGAAACAUACACGGGAAACCUCUU |
|
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.
|