Gene Page: C13orf1

Summary
GeneID  57213
Symbol  C13orf1
Synonyms  CLLD6
Description  chromosome 13 open reading frame 1
See related  HGNC:14297|MIM:607866|Ensembl:ENSG00000123178|HPRD:08486|
Locus tag  -
Gene type  protein-coding
Map location  13q14
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Pathway annotation
Pathway namePathway size# SZGR genes in pathwayInfo
WANG_LMO4_TARGETS_DN 352225All SZGR genes in this pathway
LIANG_HEMATOPOIESIS_STEM_CELL_NUMBER_LARGE_VS_TINY_DN 4524All SZGR genes in this pathway
NUYTTEN_NIPP1_TARGETS_DN 848527All SZGR genes in this pathway
RICKMAN_METASTASIS_DN 261155All SZGR genes in this pathway
SCHAEFFER_PROSTATE_DEVELOPMENT_6HR_UP 176115All SZGR genes in this pathway
TCGA_GLIOBLASTOMA_COPY_NUMBER_DN 3121All SZGR genes in this pathway
BROWNE_HCMV_INFECTION_48HR_DN 504323All SZGR genes in this pathway
LIN_NPAS4_TARGETS_UP 163100All SZGR genes in this pathway
CHANG_CORE_SERUM_RESPONSE_UP 212128All SZGR genes in this pathway
CHIANG_LIVER_CANCER_SUBCLASS_CTNNB1_UP 176110All SZGR genes in this pathway
YAGI_AML_WITH_INV_16_TRANSLOCATION 422277All SZGR genes in this pathway
BRUINS_UVC_RESPONSE_VIA_TP53_GROUP_A 898516All SZGR genes in this pathway
LEE_BMP2_TARGETS_DN 882538All SZGR genes in this pathway
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-204/2112872941A,m8hsa-miR-204brainUUCCCUUUGUCAUCCUAUGCCU
hsa-miR-211UUCCCUUUGUCAUCCUUCGCCU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.