Gene Page: SLC4A10

Summary
GeneID  57282
Symbol  SLC4A10
Synonyms  NBCn2|NCBE
Description  solute carrier family 4, sodium bicarbonate transporter, member 10
See related  HGNC:13811|MIM:605556|
Locus tag  -
Gene type  protein-coding
Map location  2q23-q24
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.02395 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005452inorganic anion exchanger activityIEA-
GO:0005215transporter activityIEA-
GO:0008509anion transmembrane transporter activityIEA-
GO:0015293symporter activityIEA-
GO:0015297antiporter activityIEA-
GO:0031402sodium ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006821chloride transportNAS10993873 
GO:0006820anion transportIEA-
GO:0006814sodium ion transportIEA-
GO:0015701bicarbonate transportNAS10993873 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016021integral to membraneNAS10993873 
GO:0005886plasma membraneIEA-
 
Pathway annotation
Pathway namePathway size# SZGR genes in pathwayInfo
HUTTMANN_B_CLL_POOR_SURVIVAL_UP 276187All SZGR genes in this pathway
GAUSSMANN_MLL_AF4_FUSION_TARGETS_A_DN 9061All SZGR genes in this pathway
TERAMOTO_OPN_TARGETS_CLUSTER_7 1916All SZGR genes in this pathway
LEE_TARGETS_OF_PTCH1_AND_SUFU_DN 8369All SZGR genes in this pathway
AFFAR_YY1_TARGETS_DN 234137All SZGR genes in this pathway
MOREAUX_MULTIPLE_MYELOMA_BY_TACI_UP 412249All SZGR genes in this pathway
MARTINEZ_RB1_TARGETS_DN 543317All SZGR genes in this pathway
MARTINEZ_TP53_TARGETS_UP 602364All SZGR genes in this pathway
MARTINEZ_RB1_AND_TP53_TARGETS_UP 601369All SZGR genes in this pathway
MCCABE_BOUND_BY_HOXC6 469239All SZGR genes in this pathway
MIKKELSEN_ES_ICP_WITH_H3K4ME3 718401All SZGR genes in this pathway
PURBEY_TARGETS_OF_CTBP1_NOT_SATB1_UP 344215All SZGR genes in this pathway
YANG_BCL3_TARGETS_UP 364236All SZGR genes in this pathway
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-125/35157641A,m8hsa-miR-125bbrainUCCCUGAGACCCUAACUUGUGA
hsa-miR-125abrainUCCCUGAGACCCUUUAACCUGUG
miR-3301551621A,m8hsa-miR-330brainGCAAAGCACACGGCCUGCAGAGA
miR-33973801A,m8hsa-miR-339UCCCUGUCCUCCAGGAGCUCA
miR-3768793m8hsa-miR-376aAUCAUAGAGGAAAAUCCACGU
hsa-miR-376bAUCAUAGAGGAAAAUCCAUGUU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.