Gene Page: HHIP

Summary
GeneID  64399
Symbol  HHIP
Synonyms  FLJ20992|FLJ90230|HIP|STQTL12
Description  hedgehog interacting protein
See related  HGNC:14866|MIM:606178|Ensembl:ENSG00000164161|HPRD:06937|
Locus tag  -
Gene type  protein-coding
Map location  4q28-q32
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003824catalytic activityIEA-
GO:0005515protein bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007405neuroblast proliferationIEAneuron (GO term level: 8)-
GO:0009953dorsal/ventral pattern formationIEA-
GO:0009887organ morphogenesisIEA-
GO:0007165signal transductionIEA-
GO:0040036regulation of fibroblast growth factor receptor signaling pathwayIEA-
GO:0030324lung developmentIEA-
GO:0045879negative regulation of smoothened signaling pathwayIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005576extracellular regionIEA-
GO:0005737cytoplasmIEA-
GO:0009986cell surfaceIEA-
GO:0005886plasma membraneIEA-
GO:0005887integral to plasma membraneIEA-
 
Pathway annotation
Pathway namePathway size# SZGR genes in pathwayInfo
KEGG_HEDGEHOG_SIGNALING_PATHWAY 5642All SZGR genes in this pathway
KEGG_PATHWAYS_IN_CANCER 328259All SZGR genes in this pathway
KEGG_BASAL_CELL_CARCINOMA 5544All SZGR genes in this pathway
PID_HEDGEHOG_2PATHWAY 2217All SZGR genes in this pathway
VECCHI_GASTRIC_CANCER_EARLY_DN 367220All SZGR genes in this pathway
SENESE_HDAC1_AND_HDAC2_TARGETS_UP 238144All SZGR genes in this pathway
SENESE_HDAC3_TARGETS_UP 501327All SZGR genes in this pathway
MOHANKUMAR_TLX1_TARGETS_DN 193112All SZGR genes in this pathway
SHETH_LIVER_CANCER_VS_TXNIP_LOSS_PAM5 9459All SZGR genes in this pathway
SCHLESINGER_METHYLATED_IN_COLON_CANCER 107All SZGR genes in this pathway
INGRAM_SHH_TARGETS_UP 12779All SZGR genes in this pathway
SCHAEFFER_PROSTATE_DEVELOPMENT_48HR_UP 487286All SZGR genes in this pathway
BENPORATH_SUZ12_TARGETS 1038678All SZGR genes in this pathway
BENPORATH_EED_TARGETS 1062725All SZGR genes in this pathway
BENPORATH_ES_WITH_H3K27ME3 1118744All SZGR genes in this pathway
BENPORATH_PRC2_TARGETS 652441All SZGR genes in this pathway
ROZANOV_MMP14_TARGETS_SUBSET 3320All SZGR genes in this pathway
ROZANOV_MMP14_TARGETS_UP 266171All SZGR genes in this pathway
SANA_RESPONSE_TO_IFNG_DN 8556All SZGR genes in this pathway
AFFAR_YY1_TARGETS_UP 214133All SZGR genes in this pathway
MARTINEZ_RB1_TARGETS_UP 673430All SZGR genes in this pathway
MARTINEZ_TP53_TARGETS_DN 593372All SZGR genes in this pathway
MARTINEZ_RB1_AND_TP53_TARGETS_DN 591366All SZGR genes in this pathway
LEE_EARLY_T_LYMPHOCYTE_UP 10759All SZGR genes in this pathway
MEISSNER_BRAIN_HCP_WITH_H3K4ME3_AND_H3K27ME3 1069729All SZGR genes in this pathway
HOELZEL_NF1_TARGETS_UP 13993All SZGR genes in this pathway
MIYAGAWA_TARGETS_OF_EWSR1_ETS_FUSIONS_UP 259159All SZGR genes in this pathway
ACEVEDO_FGFR1_TARGETS_IN_PROSTATE_CANCER_MODEL_DN 308187All SZGR genes in this pathway
NABA_SECRETED_FACTORS 344197All SZGR genes in this pathway
NABA_MATRISOME_ASSOCIATED 753411All SZGR genes in this pathway
NABA_MATRISOME 1028559All SZGR genes in this pathway
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-25/32/92/363/367395401m8hsa-miR-25brainCAUUGCACUUGUCUCGGUCUGA
hsa-miR-32UAUUGCACAUUACUAAGUUGC
hsa-miR-92UAUUGCACUUGUCCCGGCCUG
hsa-miR-367AAUUGCACUUUAGCAAUGGUGA
hsa-miR-92bSZUAUUGCACUCGUCCCGGCCUC
miR-3653339m8hsa-miR-365UAAUGCCCCUAAAAAUCCUUAU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.