Gene Page: SLC6A4

Summary
GeneID  6532
Symbol  SLC6A4
Synonyms  5-HTT|5HTT|HTT|OCD1|SERT|hSERT
Description  solute carrier family 6 (neurotransmitter transporter, serotonin), member 4
See related  HGNC:11050|MIM:182138|Ensembl:ENSG00000108576|HPRD:01640|
Locus tag  -
Gene type  protein-coding
Map location  17q11.1-q12
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
AssociationA combined odds ratio method (Sun et al. 2008), association studies2Link to SZGene
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenic, schizophrenia]Click to show detail
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 4 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0015222serotonin transmembrane transporter activityTASserotonin, Neurotransmitter (GO term level: 7)7681602 
GO:0005335serotonin:sodium symporter activityIEAserotonin, Neurotransmitter (GO term level: 10)-
GO:0005515protein bindingIPI11343649 
GO:0015293symporter activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006837serotonin transportTASserotonin, Neurotransmitter (GO term level: 5)7681602 
GO:0001504neurotransmitter uptakeTASneuron, Cholinergic, Synap, Neurotransmitter, Glial (GO term level: 8)7681602 
GO:0015844monoamine transportIDA16024787 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016020membraneIEA-
GO:0005887integral to plasma membraneTAS7681602 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
CALRCRT | FLJ26680 | RO | SSA | cC1qRcalreticulinReconstituted ComplexBioGRID10364189 
CANXCNX | FLJ26570 | IP90 | P90calnexinReconstituted ComplexBioGRID10364189 
STX1AHPC-1 | STX1 | p35-1syntaxin 1A (brain)-HPRD,BioGRID12175857 
 
Pathway annotation
Pathway namePathway size# SZGR genes in pathwayInfo
DIERICK_SEROTONIN_FUNCTION_GENES 66All SZGR genes in this pathway
NIKOLSKY_BREAST_CANCER_17Q11_Q21_AMPLICON 13378All SZGR genes in this pathway
SANSOM_APC_TARGETS_DN 366238All SZGR genes in this pathway
MARSON_BOUND_BY_FOXP3_STIMULATED 1022619All SZGR genes in this pathway
MARSON_BOUND_BY_FOXP3_UNSTIMULATED 1229713All SZGR genes in this pathway
MARTINEZ_RB1_TARGETS_DN 543317All SZGR genes in this pathway
MARTINEZ_TP53_TARGETS_UP 602364All SZGR genes in this pathway
MARTINEZ_RB1_AND_TP53_TARGETS_UP 601369All SZGR genes in this pathway
SMID_BREAST_CANCER_LUMINAL_B_UP 172109All SZGR genes in this pathway
SMID_BREAST_CANCER_BASAL_DN 701446All SZGR genes in this pathway
MEISSNER_BRAIN_HCP_WITH_H3K4ME2_AND_H3K27ME3 5935All SZGR genes in this pathway
MEISSNER_NPC_HCP_WITH_H3K4ME2 491319All SZGR genes in this pathway
MIKKELSEN_IPS_WITH_HCP_H3K27ME3 10276All SZGR genes in this pathway
BRUINS_UVC_RESPONSE_VIA_TP53_GROUP_A 898516All SZGR genes in this pathway
SUMI_HNF4A_TARGETS 3414All SZGR genes in this pathway
PEDRIOLI_MIR31_TARGETS_DN 418245All SZGR genes in this pathway
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1354364421Ahsa-miR-135aUAUGGCUUUUUAUUCCUAUGUGA
hsa-miR-135bUAUGGCUUUUCAUUCCUAUGUG
miR-15/16/195/424/497504510m8hsa-miR-15abrainUAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brainUAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrainUAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZUAGCAGCACAGAAAUAUUGGC
hsa-miR-424CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497CAGCAGCACACUGUGGUUUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.