Gene Page: SNCA

Summary
GeneID  6622
Symbol  SNCA
Synonyms  MGC110988|NACP|PARK1|PARK4|PD1
Description  synuclein, alpha (non A4 component of amyloid precursor)
See related  HGNC:11138|MIM:163890|Ensembl:ENSG00000145335|HPRD:01227|
Locus tag  -
Gene type  protein-coding
Map location  4q21
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenia, schizophrenias, schizophrenics]Click to show detail
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 7 
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0635 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
PALLD0.910.84
NR2E10.870.78
NOTCH10.860.81
SOX20.860.84
YAP10.850.75
AL161668.20.850.83
LTBP10.850.74
SIX50.840.67
FBXL70.840.80
TGIF20.840.69
Top 10 negatively co-expressed genes
SERPINI1-0.31-0.28
C5orf53-0.31-0.30
RERGL-0.30-0.35
CHN1-0.30-0.20
SERGEF-0.30-0.32
TMEM155-0.29-0.26
CA4-0.29-0.26
NRSN1-0.29-0.25
NDUFB9-0.29-0.39
ZFAND2A-0.29-0.33
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0042802identical protein bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007417central nervous system developmentTASBrain (GO term level: 6)9197268 
GO:0048169regulation of long-term neuronal synaptic plasticityIEAneuron, Synap (GO term level: 10)-
GO:0001963synaptic transmission, dopaminergicIEAneuron, Synap, Neurotransmitter, dopamine (GO term level: 8)-
GO:0048489synaptic vesicle transportIEAneuron, Synap (GO term level: 6)-
GO:0001956positive regulation of neurotransmitter secretionIEANeurotransmitter (GO term level: 10)-
GO:0042416dopamine biosynthetic processIEANeurotransmitter, dopamine (GO term level: 9)-
GO:0006644phospholipid metabolic processIEA-
GO:0006916anti-apoptosisTAS10818098 
GO:0042493response to drugIEA-
GO:0040012regulation of locomotionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0019717synaptosomeIEASynap, Brain (GO term level: 7)-
GO:0005634nucleusIEA-
GO:0005737cytoplasmTAS8248242 
GO:0016020membraneIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
APPAAA | ABETA | ABPP | AD1 | APPI | CTFgamma | CVAP | PN2amyloid beta (A4) precursor protein-HPRD,BioGRID9163350 
BADBBC2 | BCL2L8BCL2-associated agonist of cell deathReconstituted ComplexBioGRID11742726 
-HPRD10407019 
BAXBCL2L4BCL2-associated X proteinReconstituted ComplexBioGRID11742726 
BCL2L1BCL-XL/S | BCL2L | BCLX | Bcl-X | DKFZp781P2092 | bcl-xL | bcl-xSBCL2-like 1-HPRD11742726 
CALM1CALML2 | CAMI | DD132 | PHKDcalmodulin 1 (phosphorylase kinase, delta)-HPRD,BioGRID12358748 
COL25A1CLAC | CLACPcollagen, type XXV, alpha 1-HPRD15522881 
CPOXCPO | CPX | HCPcoproporphyrinogen oxidase-HPRD,BioGRID12059041 
CYCSCYC | HCScytochrome c, somatic-HPRD10506125 
ELK1-ELK1, member of ETS oncogene family-HPRD11279280 
FYNMGC45350 | SLK | SYNFYN oncogene related to SRC, FGR, YES-HPRD,BioGRID11162638 
GRK1GPRK1 | RHOK | RKG protein-coupled receptor kinase 1Biochemical ActivityBioGRID10852916 
GRK5GPRK5G protein-coupled receptor kinase 5Biochemical ActivityBioGRID10852916 
GRK6FLJ32135 | GPRK6G protein-coupled receptor kinase 6Biochemical ActivityBioGRID10852916 
LAMP2CD107b | LAMPB | LGP110lysosomal-associated membrane protein 2alpha-synuclein interacts with lamp2a. This interaction was modeled on a demonstrated interaction between human alpha-synuclein and rat lamp2a.BIND15333840 
MAP1BDKFZp686E1099 | DKFZp686F1345 | FLJ38954 | FUTSCH | MAP5microtubule-associated protein 1B-HPRD,BioGRID10764738 
MAPK1ERK | ERK2 | ERT1 | MAPK2 | P42MAPK | PRKM1 | PRKM2 | p38 | p40 | p41 | p41mapkmitogen-activated protein kinase 1Affinity Capture-WesternBioGRID12121974 
-HPRD11279280 
MAPK3ERK1 | HS44KDAP | HUMKER1A | MGC20180 | P44ERK1 | P44MAPK | PRKM3mitogen-activated protein kinase 3Affinity Capture-WesternBioGRID12121974 
MAPK8JNK | JNK1 | JNK1A2 | JNK21B1/2 | PRKM8 | SAPK1mitogen-activated protein kinase 8Affinity Capture-WesternBioGRID12121974 
MAPK8IP1IB1 | JIP-1 | JIP1 | PRKM8IPmitogen-activated protein kinase 8 interacting protein 1-HPRD11790792 
MAPTDDPAC | FLJ31424 | FTDP-17 | MAPTL | MGC138549 | MSTD | MTBT1 | MTBT2 | PPND | TAUmicrotubule-associated protein tau-HPRD,BioGRID10464279 
PARK2AR-JP | LPRS2 | PDJ | PRKNParkinson disease (autosomal recessive, juvenile) 2, parkin-HPRD,BioGRID11588587 
PLD1-phospholipase D1, phosphatidylcholine-specific-HPRD,BioGRID11821392 
PRKCEMGC125656 | MGC125657 | PKCE | nPKC-epsilonprotein kinase C, epsilon-HPRD10407019 
SEPT2DIFF6 | KIAA0158 | NEDD5 | Pnutl3 | hNedd5septin 2Affinity Capture-WesternBioGRID12695511 
SEPT4ARTS | BRADEION | CE5B3 | H5 | MART | PNUTL2 | SEP4 | hCDCREL-2 | hucep-7septin 4Affinity Capture-WesternBioGRID12695511 
SLC6A3DAT | DAT1solute carrier family 6 (neurotransmitter transporter, dopamine), member 3Alpha-synuclein interacts with hDAT.BIND14550771 
-HPRD,BioGRID12672538 
SNCAIPMGC39814 | SYPH1synuclein, alpha interacting proteinAffinity Capture-Western
FRET
Reconstituted Complex
Two-hybrid		BioGRID10319874 |11331421 
|11742726 |12044636 
SNCAIP interacts with SNCA.BIND10319874 
-HPRD10319874 |11331421 
|12044636 
SNCB-synuclein, beta-HPRD,BioGRID11683992 
SQSTM1A170 | OSIL | PDB3 | ZIP3 | p60 | p62 | p62Bsequestosome 1-HPRD11447312 
THTYHtyrosine hydroxylase-HPRD11943812 
TOR1ADQ2 | DYT1torsin family 1, member A (torsin A)-HPRD,BioGRID11438481 
TUBA1AB-ALPHA-1 | FLJ25113 | LIS3 | TUBA3tubulin, alpha 1a-HPRD11687285 
UCHL1PARK5 | PGP9.5 | Uch-L1ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)-HPRD11603807 
YWHABGW128 | HS1 | KCIP-1tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide-HPRD10407019 
YWHAE14-3-3E | FLJ45465 | KCIP-1 | MDCR | MDStyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide-HPRD10407019 
 
Pathway annotation
Pathway namePathway size# SZGR genes in pathwayInfo
KEGG_ALZHEIMERS_DISEASE 169110All SZGR genes in this pathway
KEGG_PARKINSONS_DISEASE 13378All SZGR genes in this pathway
BIOCARTA_PARKIN_PATHWAY 138All SZGR genes in this pathway
PID_ALPHA_SYNUCLEIN_PATHWAY 3325All SZGR genes in this pathway
REACTOME_AMYLOIDS 8363All SZGR genes in this pathway
ONKEN_UVEAL_MELANOMA_DN 526357All SZGR genes in this pathway
DIAZ_CHRONIC_MEYLOGENOUS_LEUKEMIA_UP 1382904All SZGR genes in this pathway
SENESE_HDAC3_TARGETS_DN 536332All SZGR genes in this pathway
JAATINEN_HEMATOPOIETIC_STEM_CELL_DN 226132All SZGR genes in this pathway
WAMUNYOKOLI_OVARIAN_CANCER_GRADES_1_2_DN 6743All SZGR genes in this pathway
RODRIGUES_THYROID_CARCINOMA_POORLY_DIFFERENTIATED_UP 633376All SZGR genes in this pathway
HAHTOLA_SEZARY_SYNDROM_UP 9858All SZGR genes in this pathway
HAHTOLA_MYCOSIS_FUNGOIDES_SKIN_UP 177113All SZGR genes in this pathway
HAHTOLA_MYCOSIS_FUNGOIDES_UP 1915All SZGR genes in this pathway
TANG_SENESCENCE_TP53_TARGETS_UP 3320All SZGR genes in this pathway
XU_HGF_TARGETS_INDUCED_BY_AKT1_48HR_DN 2717All SZGR genes in this pathway
DAIRKEE_TERT_TARGETS_UP 380213All SZGR genes in this pathway
CEBALLOS_TARGETS_OF_TP53_AND_MYC_DN 3831All SZGR genes in this pathway
SHETH_LIVER_CANCER_VS_TXNIP_LOSS_PAM1 229137All SZGR genes in this pathway
AMIT_SERUM_RESPONSE_20_MCF10A 2110All SZGR genes in this pathway
ONDER_CDH1_TARGETS_2_DN 464276All SZGR genes in this pathway
LE_EGR2_TARGETS_DN 10884All SZGR genes in this pathway
TARTE_PLASMA_CELL_VS_PLASMABLAST_UP 398262All SZGR genes in this pathway
MOREAUX_MULTIPLE_MYELOMA_BY_TACI_UP 412249All SZGR genes in this pathway
VERHAAK_AML_WITH_NPM1_MUTATED_DN 246180All SZGR genes in this pathway
HOEGERKORP_CD44_TARGETS_TEMPORAL_DN 2516All SZGR genes in this pathway
IVANOVA_HEMATOPOIESIS_MATURE_CELL 293160All SZGR genes in this pathway
BLALOCK_ALZHEIMERS_DISEASE_DN 1237837All SZGR genes in this pathway
LEE_AGING_CEREBELLUM_DN 8666All SZGR genes in this pathway
BROWNE_HCMV_INFECTION_48HR_UP 180125All SZGR genes in this pathway
XU_GH1_EXOGENOUS_TARGETS_UP 8550All SZGR genes in this pathway
RODWELL_AGING_KIDNEY_UP 487303All SZGR genes in this pathway
XU_GH1_AUTOCRINE_TARGETS_UP 268157All SZGR genes in this pathway
HOWLIN_CITED1_TARGETS_1_UP 3525All SZGR genes in this pathway
ZHENG_BOUND_BY_FOXP3 491310All SZGR genes in this pathway
MARTINEZ_RB1_TARGETS_UP 673430All SZGR genes in this pathway
MARTINEZ_TP53_TARGETS_DN 593372All SZGR genes in this pathway
MARTINEZ_RB1_AND_TP53_TARGETS_DN 591366All SZGR genes in this pathway
GRADE_COLON_AND_RECTAL_CANCER_DN 10165All SZGR genes in this pathway
MALONEY_RESPONSE_TO_17AAG_DN 7945All SZGR genes in this pathway
MOOTHA_MITOCHONDRIA 447277All SZGR genes in this pathway
YOSHIMURA_MAPK8_TARGETS_UP 1305895All SZGR genes in this pathway
SWEET_LUNG_CANCER_KRAS_DN 435289All SZGR genes in this pathway
VALK_AML_CLUSTER_8 2617All SZGR genes in this pathway
MIKKELSEN_IPS_ICP_WITH_H3K4ME3_AND_H327ME3 12683All SZGR genes in this pathway
HAHTOLA_CTCL_CUTANEOUS 2619All SZGR genes in this pathway
DANG_REGULATED_BY_MYC_DN 253192All SZGR genes in this pathway
RAGHAVACHARI_PLATELET_SPECIFIC_GENES 7046All SZGR genes in this pathway
PILON_KLF1_TARGETS_UP 504321All SZGR genes in this pathway
BRUINS_UVC_RESPONSE_VIA_TP53_GROUP_A 898516All SZGR genes in this pathway
ISSAEVA_MLL2_TARGETS 6235All SZGR genes in this pathway
VANDESLUIS_COMMD1_TARGETS_GROUP_3_UP 8950All SZGR genes in this pathway
SERVITJA_ISLET_HNF1A_TARGETS_UP 163111All SZGR genes in this pathway
PLASARI_NFIC_TARGETS_BASAL_UP 2717All SZGR genes in this pathway
PHONG_TNF_RESPONSE_VIA_P38_PARTIAL 160106All SZGR genes in this pathway
FOSTER_KDM1A_TARGETS_UP 266142All SZGR genes in this pathway
LIM_MAMMARY_STEM_CELL_UP 489314All SZGR genes in this pathway
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-153459465m8hsa-miR-153UUGCAUAGUCACAAAAGUGA
miR-324-3p1311371Ahsa-miR-324-3pCCACUGCCCCAGGUGCUGCUGG
miR-4954174231Ahsa-miR-495brainAAACAAACAUGGUGCACUUCUUU
miR-53989961A,m8hsa-miR-539GGAGAAAUUAUCCUUGGUGUGU
miR-71201271A,m8hsa-miR-7SZUGGAAGACUAGUGAUUUUGUUG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.