Gene Page: LAT2

Summary
GeneID  7462
Symbol  LAT2
Synonyms  HSPC046|LAB|NTAL|WBSCR15|WBSCR5|WSCR5
Description  linker for activation of T cells family, member 2
See related  HGNC:12749|MIM:605719|Ensembl:ENSG00000086730|HPRD:09304|
Locus tag  -
Gene type  protein-coding
Map location  7q11.23
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI14722116 
GO:0042169SH2 domain bindingIMP14722116 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0043303mast cell degranulationIEAserotonin (GO term level: 9)-
GO:0007242intracellular signaling cascadeIGI14722116 
GO:0006955immune responseIEA-
GO:0019722calcium-mediated signalingIGI14722116 
GO:0042113B cell activationIDA12514734 
GO:0042113B cell activationTAS14722116 
GO:0050853B cell receptor signaling pathwayIDA12514734 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016021integral to membraneIEA-
GO:0005886plasma membraneIEA-
GO:0045121membrane raftIDA12486104 |12514734 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
BLNKBASH | BLNK-S | LY57 | MGC111051 | SLP-65 | SLP65B-cell linker-HPRD12514734 
GRB2ASH | EGFRBP-GRB2 | Grb3-3 | MST084 | MSTP084growth factor receptor-bound protein 2-HPRD,BioGRID12514734 
PLCG1PLC-II | PLC1 | PLC148 | PLCgamma1phospholipase C, gamma 1-HPRD,BioGRID12514734 
PLCG2-phospholipase C, gamma 2 (phosphatidylinositol-specific)-HPRD,BioGRID12514734 
 
Pathway annotation
Pathway namePathway size# SZGR genes in pathwayInfo
PID_FCER1_PATHWAY 6243All SZGR genes in this pathway
ZHONG_RESPONSE_TO_AZACITIDINE_AND_TSA_UP 183119All SZGR genes in this pathway
FULCHER_INFLAMMATORY_RESPONSE_LECTIN_VS_LPS_UP 579346All SZGR genes in this pathway
RHEIN_ALL_GLUCOCORTICOID_THERAPY_DN 362238All SZGR genes in this pathway
MULLIGHAN_MLL_SIGNATURE_1_UP 380236All SZGR genes in this pathway
MULLIGHAN_MLL_SIGNATURE_2_UP 418263All SZGR genes in this pathway
TONKS_TARGETS_OF_RUNX1_RUNX1T1_FUSION_HSC_DN 187115All SZGR genes in this pathway
SENESE_HDAC1_AND_HDAC2_TARGETS_DN 232139All SZGR genes in this pathway
SENESE_HDAC3_TARGETS_DN 536332All SZGR genes in this pathway
KIM_WT1_TARGETS_12HR_DN 209122All SZGR genes in this pathway
MARKEY_RB1_ACUTE_LOF_UP 215137All SZGR genes in this pathway
EBAUER_TARGETS_OF_PAX3_FOXO1_FUSION_UP 207128All SZGR genes in this pathway
PEREZ_TP53_TARGETS 1174695All SZGR genes in this pathway
LINDGREN_BLADDER_CANCER_CLUSTER_2B 392251All SZGR genes in this pathway
FURUKAWA_DUSP6_TARGETS_PCI35_DN 7440All SZGR genes in this pathway
NUYTTEN_EZH2_TARGETS_DN 1024594All SZGR genes in this pathway
KOYAMA_SEMA3B_TARGETS_UP 292168All SZGR genes in this pathway
AMIT_EGF_RESPONSE_120_HELA 6947All SZGR genes in this pathway
MORI_LARGE_PRE_BII_LYMPHOCYTE_DN 5839All SZGR genes in this pathway
MORI_IMMATURE_B_LYMPHOCYTE_UP 5335All SZGR genes in this pathway
MORI_MATURE_B_LYMPHOCYTE_UP 9062All SZGR genes in this pathway
ROSS_ACUTE_MYELOID_LEUKEMIA_CBF 8257All SZGR genes in this pathway
ROSS_AML_WITH_AML1_ETO_FUSION 7655All SZGR genes in this pathway
SANSOM_APC_TARGETS_DN 366238All SZGR genes in this pathway
XU_CREBBP_TARGETS_DN 4431All SZGR genes in this pathway
BRUNO_HEMATOPOIESIS 6648All SZGR genes in this pathway
RAMALHO_STEMNESS_DN 7455All SZGR genes in this pathway
BLALOCK_ALZHEIMERS_DISEASE_UP 16911088All SZGR genes in this pathway
SAGIV_CD24_TARGETS_DN 4626All SZGR genes in this pathway
GOLDRATH_ANTIGEN_RESPONSE 346192All SZGR genes in this pathway
HOFFMANN_SMALL_PRE_BII_TO_IMMATURE_B_LYMPHOCYTE_UP 7049All SZGR genes in this pathway
CHEN_METABOLIC_SYNDROM_NETWORK 1210725All SZGR genes in this pathway
VALK_AML_CLUSTER_13 3020All SZGR genes in this pathway
POOLA_INVASIVE_BREAST_CANCER_UP 288168All SZGR genes in this pathway
LI_INDUCED_T_TO_NATURAL_KILLER_UP 307182All SZGR genes in this pathway
MARTENS_TRETINOIN_RESPONSE_DN 841431All SZGR genes in this pathway
BRUINS_UVC_RESPONSE_VIA_TP53_GROUP_A 898516All SZGR genes in this pathway
BRUINS_UVC_RESPONSE_VIA_TP53_GROUP_D 280158All SZGR genes in this pathway
HUANG_GATA2_TARGETS_UP 14996All SZGR genes in this pathway
FORTSCHEGGER_PHF8_TARGETS_DN 784464All SZGR genes in this pathway
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-155513519m8hsa-miR-155UUAAUGCUAAUCGUGAUAGGGG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.