|
GeneID |
84152
|
Symbol |
PPP1R1B
|
Synonyms |
DARPP-32|DARPP32|FLJ20940
|
Description |
protein phosphatase 1, regulatory (inhibitor) subunit 1B |
See related |
HGNC:9287|MIM:604399|Ensembl:ENSG00000131771|HPRD:05097| |
Locus tag |
- |
Gene type |
protein-coding |
Map location |
17q12 |
|
|
|
|
General Gene Expression (microarray) ? |
|
|
|
Gene Expression in Brain Regions (new) |
|
|
Top co-expressed genes in Brain Regions (new) |
|
Gene | Pearson's Correlation | Spearman's Correlation | | |
Top 10 positively co-expressed genes |
Top 10 negatively co-expressed genes | |
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|
GO:0004864 | protein phosphatase inhibitor activity | TAS | | 10604473 |
GO:0004860 | protein kinase inhibitor activity | TAS | | 10604473 |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
---|
GO:0006350 | transcription | IEA | | - |
GO:0007165 | signal transduction | TAS | | 10604473 |
GO:0007621 | negative regulation of female receptivity | IEA | | - |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
---|
GO:0005737 | cytoplasm | NAS | | - |
|
|
|
|
|
|
|
miR-330 | 600 | 607 | 1A,m8 | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA |
|
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.
|